Novel polynucleotides and polypeptides encoded thereby (2024)

This application claims priority from Provisional Applications U.S. Ser. No. 60/214,759, filed Jun. 5, 27, 2000; U.S. Ser. No. 60/244,546, filed Oct. 31, 2000; U.S. Ser. No. 60/263,215, filed Jan. 22, 2001; U.S. Ser. No. 60/261,014, filed Jan. 11, 2001; and U.S. Ser. No. 60/248,153, filed Nov. 13, 2000, each of which is incorporated herein by reference in its entirety.

The invention generally relates to nucleic acids and polypeptides encoded therefrom.

The invention generally relates to nucleic acids and polypeptides encoded therefrom. More specifically, the invention relates to nucleic acids encoding cytoplasmic, nuclear, membrane bound, and secreted polypeptides, as well as vectors, host cells, antibodies, and recombinant methods for producing these nucleic acids and polypeptides.

The invention is based in part upon the discovery of nucleic acid sequences encoding novel polypeptides. The novel nucleic acids and polypeptides are referred to herein as NOVX, or NOV1a, NOV1b, NOV2, NOV3, NOV4, NOV5, NOV6a, NOV6b, NOV6c, NOV6d, NOV7a, NOV7b, an d NOV7c nucleic acids and polypeptides. These nucleic acids and polypeptides, as well as derivatives, hom*ologs, analogs and fragments thereof, will hereinafter be collectively designated as “NOVX” nucleic acid or polypeptide sequences.

In one aspect, the invention provides an isolated NOVX nucleic acid molecule encoding a NOVX polypeptide that includes a nucleic acid sequence that has identity to the nucleic acids disclosed in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 16, 17, 19, 21, 23, 25 and 27. In some embodiments, the NOVX nucleic acid molecule will hybridize under stringent conditions to a nucleic acid sequence complementary to a nucleic acid molecule that includes a protein-coding sequence of a NOVX nucleic acid sequence. The invention also includes an isolated nucleic acid that encodes a NOVX polypeptide, or a fragment, hom*olog, analog or derivative thereof. For example, the nucleic acid can encode a polypeptide at least 80% identical to a polypeptide comprising the amino acid sequences of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 18, 20, 22, 24, 26 and 28. The nucleic acid can be, for example, a genomic DNA fragment or a cDNA molecule that includes the nucleic acid sequence of any of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 16, 17, 19, 21, 23, 25 and 27.

Also included in the invention is an oligonucleotide, e.g., an oligonucleotide which includes at least 6 contiguous nucleotides of a NOVX nucleic acid (e.g., SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 16, 17, 19, 21, 23, 25 and 27) or a complement of said oligonucleotide.

Also included in the invention are substantially purified NOVX polypeptides (SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 18, 20, 22, 24, 26 and 28). In certain embodiments, the NOVX polypeptides include an amino acid sequence that is substantially identical to the amino acid sequence of a human NOVX polypeptide.

The invention also features antibodies that immunoselectively bind to NOVX polypeptides, or fragments, hom*ologs, analogs or derivatives thereof.

In another aspect, the invention includes pharmaceutical compositions that include therapeutically- or prophylactically-effective amounts of a therapeutic and a pharmaceutically-acceptable carrier. The therapeutic can be, e.g., a NOVX nucleic acid, a NOVX polypeptide, or an antibody specific for a NOVX polypeptide. In a further aspect, the invention includes, in one or more containers, a therapeutically- or prophylactically-effective amount of this pharmaceutical composition.

In a further aspect, the invention includes a method of producing a polypeptide by culturing a cell that includes a NOVX nucleic acid, under conditions allowing for expression of the NOVX polypeptide encoded by the DNA. If desired, the NOVX polypeptide can then be recovered.

In another aspect, the invention includes a method of detecting the presence of a NOVX polypeptide in a sample. In the method, a sample is contacted with a compound that selectively binds to the polypeptide under conditions allowing for formation of a complex between the polypeptide and the compound. The complex is detected, if present, thereby identifying the NOVX polypeptide within the sample.

The invention also includes methods to identify specific cell or tissue types based on their expression of a NOVX.

Also included in the invention is a method of detecting the presence of a NOVX nucleic acid molecule in a sample by contacting the sample with a NOVX nucleic acid probe or primer, and detecting whether the nucleic acid probe or primer bound to a NOVX nucleic acid molecule in the sample.

In a further aspect, the invention provides a method for modulating the activity of a NOVX polypeptide by contacting a cell sample that includes the NOVX polypeptide with a compound that binds to the NOVX polypeptide in an amount sufficient to modulate the activity of said polypeptide. The compound can be, e.g., a small molecule, such as a nucleic acid, peptide, polypeptide, peptidomimetic, carbohydrate, lipid or other organic (carbon containing) or inorganic molecule, as further described herein.

Also within the scope of the invention is the use of a therapeutic in the manufacture of a medicament for treating or preventing disorders or syndromes including, e.g., diabetes, metabolic disturbances associated with obesity, the metabolic syndrome X, anorexia, wasting disorders associated with chronic diseases, metabolic disorders, diabetes, obesity, infectious disease. anorexia, cancer-associated cachexia, cancer, neurodegenerative disorders, Alzheimer's Disease, Parkinson's Disorder, immune disorders, and hematopoietic disorders, or other disorders related to cell signal processing and metabolic pathway modulation. The therapeutic can be, e.g., a NOVX nucleic acid, a NOVX polypeptide, or a NOVX-specific antibody, or biologically-active derivatives or fragments thereof.

For example, the compositions of the present invention will have efficacy for treatment of patients suffering from: developmental diseases, MHCII and III diseases (immune diseases), taste and scent detectability Disorders, Burkitt's lymphoma, corticoneurogenic disease, signal transduction pathway disorders, Retinal diseases including those involving photoreception, Cell growth rate disorders; cell shape disorders, feeding disorders; control of feeding; potential obesity due to over-eating; potential disorders due to starvation (lack of appetite), noninsulin-dependent diabetes mellitus (NIDDM 1), bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2), pain, cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterus cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease; multiple sclerosis; Albright Hereditary Ostoeodystrophy, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation. Dentatorubro-pallidoluysian atrophy (DRPLA) Hypophosphatemic rickets, autosomal dominant (2) Acrocallosal syndrome and dyskinesias, such as Huntington's disease or Gilles de la Tourette syndrome and/or other pathologies and disorders of the like.

The polypeptides can be used as immunogens to produce antibodies specific for the invention, and as vaccines. They can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding NOVX may be useful in gene therapy, and NOVX may be useful when administered to a subject in need thereof. By way of non-limiting example, the compositions of the present invention will have efficacy for treatment of patients suffering from bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2), pain, cancer (including but not limited to Neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterus cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease; multiple sclerosis; and Treatment of Albright Hereditary Ostoeodystrophy, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and dyskinesias, such as Huntington's disease or Gilles de la Tourette syndrome and/or other pathologies and disorders.

The invention further includes a method for screening for a modulator of disorders or syndromes including, e.g., diabetes, metabolic disturbances associated with obesity, the metabolic syndrome X, anorexia, wasting disorders associated with chronic diseases, metabolic disorders, diabetes, obesity, infectious disease, anorexia, cancer-associated cachexia, cancer, neurodegenerative disorders, Alzheimer's Disease, Parkinson's Disorder, immune disorders, and hematopoietic disorders or other disorders related to cell signal processing and metabolic pathway modulation. The method includes contacting a test compound with a NOVX polypeptide and determining if the test compound binds to said NOVX polypeptide. Binding of the test compound to the NOVX polypeptide indicates the test compound is a modulator of activity, or of latency or predisposition to the aforementioned disorders or syndromes.

Also within the scope of the invention is a method for screening for a modulator of activity, or of latency or predisposition to an disorders or syndromes including, e.g., diabetes, metabolic disturbances associated with obesity, the metabolic syndrome X, anorexia, wasting disorders associated with chronic diseases, metabolic disorders, diabetes, obesity, infectious disease, anorexia, cancer-associated cachexia, cancer, neurodegenerative disorders, Alzheimer's Disease, Parkinson's Disorder, immune disorders, and hematopoietic disorders or other disorders related to cell signal processing and metabolic pathway modulation by administering a test compound to a test animal at increased risk for the aforementioned disorders or syndromes. The test animal expresses a recombinant polypeptide encoded by a NOVX nucleic acid. Expression or activity of NOVX polypeptide is then measured in the test animal, as is expression or activity of the protein in a control animal which recombinantly-expresses NOVX polypeptide and is not at increased risk for the disorder or syndrome. Next. the expression of NOVX polypeptide in both the test animal and the control animal is compared. A change in the activity of NOVX polypeptide in the test animal relative to the control animal indicates the test compound is a modulator of latency of the disorder or syndrome.

In yet another aspect, the invention includes a method for determining the presence of or predisposition to a disease associated with altered levels of a NOVX polypeptide, a NOVX nucleic acid, or both, in a subject (e.g., a human subject). The method includes measuring the amount of the NOVX polypeptide in a test sample from the subject and comparing the amount of the polypeptide in the test sample to the amount of the NOVX polypeptide present in a control sample. An alteration in the level of the NOVX polypeptide in the test sample as compared to the control sample indicates the presence of or predisposition to a disease in the subject. Preferably, the predisposition includes, e.g., diabetes, metabolic disturbances associated with obesity, the metabolic syndrome X, anorexia, wasting disorders associated with chronic diseases, metabolic disorders, diabetes, obesity, infectious disease, anorexia, cancer-associated cachexia, cancer, neurodegenerative disorders, Alzheimer's Disease, Parkinson's Disorder, immune disorders, and hematopoietic disorders. Also, the expression levels of the new polypeptides of the invention can be used in a method to screen for various cancers as well as to determine the stage of cancers.

In a further aspect, the invention includes a method of treating or preventing a pathological condition associated with a disorder in a mammal by administering to the subject a NOVX polypeptide, a NOVX nucleic acid, or a NOVX-specific antibody to a subject (e.g., a human subject), in an amount sufficient to alleviate or prevent the pathological condition. In preferred embodiments, the disorder, includes, e.g., diabetes, metabolic disturbances associated with obesity, the metabolic syndrome X, anorexia, wasting disorders associated with chronic diseases, metabolic disorders, diabetes, obesity, infectious disease, anorexia, cancer-associated cachexia, cancer, neurodegenerative disorders, Alzheimer's Disease, Parkinson's Disorder, immune disorders, and hematopoietic disorders.

In yet another aspect, the invention can be used in a method to identity the cellular receptors and downstream effectors of the invention by any one of a number of techniques commonly employed in the art. These include but are not limited to the two-hybrid system, affinity purification, co-precipitation with antibodies or other specific-interacting molecules.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description and claims.

NOVX nucleic acids and their encoded polypeptides are useful in a variety of applications and contexts. The various NOVX nucleic acids and polypeptides according to the invention are useful as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. Additionally, NOVX nucleic acids and polypeptides can also be used to identify proteins that are members of the family to which the NOVX polypeptides belong.

For example, NOV1 is hom*ologous to members of Irregular Chiasm C Roughest family of proteins that are important cell adhesion molecules and members of the immunoglobulin superfamily. Thus, the NOV1 nucleic acids, polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in disorders characterized by cell migration, invasion and tumor metastasis, e.g., lymphoproliferative disease.

Also, NOV2 is hom*ologous to low density lipoprotein (LDL) receptor related protein family. Thus NOV2 may function similarly to other members of the LDL receptor family. Consequently, the NOV2 nucleic acids, polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in disorders characterized by e.g., high levels of cholesterol-rich LDL in the plasma, eg., familial hypercholesterolemia.

Further, NOV3 is hom*ologous to a family of small inducible cytokine proteins that include GRO proteins and Interleukin-8 (IL-8). Thus, the NOV3 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic applications in various disorders involving GRO proteins, IL-8 and/or other members of the same family. Specific examples of these disorders include, for example, Crohn's disease, inflammatory bowel disease, ulcerative colitis and various types of cancers.

Also, NOV4 is hom*ologous to the cell cycle and proliferative proteins important in cell cycle regulation and cell proliferation. Thus, NOV4 nucleic acids, polypeptides, antibodies and related compounds according to the invention will be useful, for example, in therapeutic and diagnostic applications in various immune, developmental and cell signaling disorders and cell proliferative disorders including cancer.

Additionally, NOV5 is hom*ologous to the cadherin family of proteins. Thus NOV5 nucleic acids, polypeptides, antibodies and related compounds according to the invention will be useful in treating a variety of conditions, including, e.g., immune deficiencies and disorders, viral, bacterial and other infections, and cell proliferative disorders.

Further, NOV6 is hom*ologous to the lysozyme C-1 family of proteins. Thus, NOV6 nucleic acids, polypeptides, antibodies and related compounds according to the invention will be useful in treating a variety of conditions, including, e.g., bacterial, fungal, protozoal and viral infections, amyloidosis, blood disorders, salivitory disorders, digestive disorders, oral immunologic disorders, poor oral health, inflammatory processes, muscle, bone and tendon disorders, and/or other pathologies and disorders of the like.

Finally, NOV7 is hom*ologous to members of IgG-like proteins that are important protease inhibitors and cancer antigens. Thus, the NOV7 nucleic acids, polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in disorders (e.g., proliferative disorders) characterized by protease inhibition and carcinoma.

The NOVX nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOVX activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., neurogenesis, cell differentiation, cell proliferation, hematopoiesis, wound healing and angiogenesis.

Additional utilities for the NOVX nucleic acids and polypeptides according to the invention are disclosed herein.

NOV1

NOV1 includes a family of two similar nucleic acids and two similar proteins disclosed below. They are novel members of the Ig superfamily of proteins, as demonstrated by the presence of identifiable Ig domains contained within NOV1.

NOV1a

The disclosed amino acid sequence for NOV1a has 410/410 (1 00%) identical to a 410 amino acid hom*o sapiens irregular chiasm c-roughest protein precursor (ACC:BAA91850) (cDNA FLJ10845 FIS, Clone NT2RP4001372) (score=2161 (760.7 bits); E=8.3e-224). The disclosed NOV1a amino acid sequence also has 89/291 (30%) identical and 139/291 (47%) positives with a 764 amino acid ACC:A08180 Irregular Chiasm C-Roughest Protein Precursor (IRREC PROTEIN) from Drosophila melanogaster (score=351 (123.6 bits); E=3.8e-59).

The roughest-irregular chiasm C protein is a cell adhesion molecule that is a transmembrane glycoprotein of the immunoglobulin superfamily involved in several important developmental processes in Drosophila. These include axonal pathfinding in the optic lobe and programmed cell death and pigment cell differentiation in the pupal retina. See Moda et al., An Acad Bras Cienc 72(3):381-88 (2000). Additionally, this protein plays a role in patterning sense organs on the Drosophila antenna. See Venugopala Reddy et al., Dev Genes Evol 209(10):581-91 (1999). Pattern formation in the developing Drosophila retina involves the elimination of excess cells between ommatidia and the differentiation of the remaining cells into secondary and tertiary pigment cells. See Reiter et al., Development 122(6):1931-40 (1996). Irregular chiasmC-roughest protein is essential for correct sorting of cell-cell contacts in the pupal retina. See id.

In all BLAST alignments herein, the “E-value” or “Expect” value is a numeric indication of the probability that the aligned sequences could have achieved their similarity to the BLAST query sequence by chance alone, within the database that was searched. For example, the probability that the subject (“Sbjct”) retrieved from the IIT BLAST analysis, matched the Query IIT sequence purely by chance is the E value. The Expect value (E) is a parameter that describes the number of hits one can “expect” to see just by chance when searching a database of a particular size. It decreases exponentially with the Score (S) that is assigned to a match between two sequences. Essentially, the E value describes the random background noise that exists for matches between sequences. Blasting is performed against public nucleotide databases such as GenBank databases and the GeneSeq patent database. For example, BLASTX searching is performed against public protein databases, which include GenBank databases, SwissProt, PDB and PIR.

The Expect value is used as a convenient way to create a significance threshold for reporting results. The default value used for blasting is typically set to 0.0001. In BLAST 2.0, the Expect value is also used instead of the P value (probability) to report the significance of matches. For example, an E value of one assigned to a hit can be interpreted as meaning that in a database of the current size one might expect to see one match with a similar score simply by chance. An E value of zero means that one would not expect to see any matches with a similar score simply by chance. See, e.g., http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/. Occasionally, a string of X's or N's will result from a BLAST search. This is a result of automatic filtering of the query for low-complexity sequence that is performed to prevent artifactual hits. The filter substitutes any low-complexity sequence that it finds with the letter “N” in nucleotide sequence (e.g., “NNNNNNNNNNNNN”) or the letter “X” in protein sequences (e.g., “XXXXXXXXX”). Low-complexity regions can result in high scores that reflect compositional bias rather than significant position-by-position alignment. Wootton and Federhen, Methods Enzymol 266:554-571, 1996.

Variant sequences are also included in this application. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA. A SNP can arise in several ways. For example, a SNP may be due to a substitution of one nucleotide for another at the polymorphic site. Such a substitution can be either a transition or a transversion. A SNP can also arise from a deletion of a nucleotide or an insertion of a nucleotide, relative to a reference allele. In this case, the polymorphic site is a site at which one allele bears a gap with respect to a particular nucleotide in another allele. SNPs occurring within genes may result in an alteration of the amino acid encoded by the gene at the position of the SNP. Intragenic SNPs may also be silent, when a codon including a SNP encodes the same amino acid as a result of the redundancy of the genetic code. SNPs occurring outside the region of a gene, or in an intron within a gene, do not result in changes in any amino acid sequence of a protein but may result in altered regulation of the expression pattern. Examples include alteration in temporal expression, physiological response regulation, cell type expression regulation, intensity of expression, and stability of transcribed message.

NOV1b

The encoded NOV1b protein is presented in Table 1E. The disclosed protein is 334 amino acids long and is denoted by SEQ ID NO:4. The Psort profile for NOV1b predicts that this sequence likely has no signal peptide and is likely to be localized in the cytoplasm with a certainty of 0.4500; microbody (peroxisome) with a certainty of 0.3235; lysosome (lumen) with a certainty of 0.2075; and mitochondrial matrix space with a certainty of 0.1000. The disclosed NOV1b protein is expressed in the lymph node, ovary, and adrenal gland. The disclosed NOV1b protein is a member of the Ig superfamily, demonstrated by its hom*ology to identifiable Ig domains contained therein.

The disclosed NOV1b amino acid sequence has 77/205 (37%) identical and 106/205 (51%) with a 764 amino acid ACC:18180 Irregular Chiasm C-Roughest Protein Precursor (IRREC PROTEIN) from Drosophila melanogaster (score=326 (114.8 bits); E=2.3e-28). Additionally, the disclosed NOV1b protein has 59/199 (29%) identical and 93/199 (46%) positives with a 1241 amino acid ACC:O60500 Nephrin from hom*o sapiens. As noted above, the Irregular Chiasm C-Roughest Protein is an adhesion molecule that is a member of the immunoglobulin superfamily. Likewise, nephrin is a putative member of the immunoglobulin of cell adhesion molecules. See Kestilia et al., Molec. Cell 1:575-82 (1998);OMIM 602716. Nephrin contains a transmembrane domain, eight Ig-like modules, and one fibronectin III-like module. See id. This protein has been shown to be specifically expresses in renal glomeruli, and it plays a crucial role in the development or function of the kidney filtration barrier. Putaala et al., Hum. Molec. Genet. 10:1-8 (2001) generated a mouse model for congenital nephritic syndrome by inactivating the nephrin gene in embryonic stem cell by hom*ologous recombination.

Other BLAST results include sequences from the Patp database, which is a proprietary database that contains sequences published in patents and patent publications. Patp results for NOV1 include those listed in Table 1H and 1I.

For example, a BLAST against ORF785, a 126 amino acid human ORFX from hom*o sapiens produced 126/126 (100%) identity and 126/126 (100%) positives (E=2.0e-62) with NOV1a. WO00/58473. Additionally, a BLAST against ORF785, produced 126/126 (100%) identity and 126/126 (100%) positives (E=1.6e-45) with NOV1b.

Unless specifically addressed as NOV1a or NOV1b any reference to NOV1 is assumed to encompass all variants. Residue differences between any NOVX variant sequences herein are written to show the residue in the “a” variant and the residue position with respect to the “a” variant. NOV residues in all following sequence alignments that differ between the individual NOV variants are highlighted with a box and marked with the (o) symbol above the variant residue in all alignments herein.

This information is presented graphically in the multiple sequence alignment given in Table 1J (with NOV1a being shown on line 1) as a ClustalW analysis comparing NOV1 with related protein sequences.

NOV1 has been localized to chromosome 1. A BLAST of the NOV1 nucleic acids against the 154,998 bp hom*o sapiens chromosome 1 clone RPI11-444M10 (acc:AL139010.8) yielded 1375/1414 (97%) identical and 1375/1414 (97%) positives (E=0.0; strand=minus/plus) from nucleotides 125669 to 127081. Likewise, NOV1 had 249/276 (90%) identical and 249/276 (90%) positives (E=1.8e-193; strand=minus/plus) from nucleotides 16632 to 16909 of this chromosome 1 clone; 172/189 (91%) identical and 172/189 (91%) positives (E=1.8e-193; strand =minus/plus) from nucleotides 20136 to 20324; 159/169 (94%) identical and 159/169 (94%) positives (E=1.8e-193; strand=minus/plus) from nucleotides 111311 to 111340; 140/140 (100%) identical and 140/140 (100%) positives (E=0.0; strand=minus/plus) from nucleotides 127963 to 128102; 133/135 (98%) identical and 133/135 (98%) positives (E=1.8e-193; strand=minus/plus) from nucleotides 19837 to 19971; 129/129 (100%) identical and 129/129 (100%) positives (E=1.8e-193; strand=minus/plus) from nucleotides 139891 to 139958; and 94/95 (98%) identical and 94/95 (98%) positives (E=1.8e-193; strand=minus/plus) from nucleotides 20942 to 21035. Additionally, a BLAST of NOV1 against the 195115 bp hom*o sapiens chromosome 1 clone RPI1-404013 (acc:AL1138899.10) produced 63165 (96%) identical and 63/65 (96%) positives (E=0.0047; strand=plus/plus) from nucleotides 90500 to 90564 of this chromosome 1 clone; 1408/1415 (99%) identical and 1408/1415 (99%) positives (E=0.0; strand=minus/plus) from nucleotides 164149 to 165563; 162/164 (98%) identical and 162/164 (98%) positives (E=0.0; strand=minus/plus) from nucleotides 174892 to 175055; 152/152 (100%) identical and 152/152 (100%) positives (E=0.0; strand=minus/plus) from nucleotides 172726 to 172877; 159/168 (94%) identical and 159/168 (94%) positives (E=0.0; strand=minus/plus) from nucleotides 183193 to 183360; 140/140 (100%) identical and 140/140 (100%) positives (E=0.0; strand=minus/plus) from nucleotides 16644. to 166582; and 129/129 (100%) identical and 129/129 (100%) positives (E-0.0; strand=minus/plus) from nucleotides 170576to 170704.

The presence of identifiable domains in NOV1 was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/).

NOV1 is a member of the immunoglobulin (Ig) superfamily. Members of this superfamily have a variety of functions, but all appear to play a role in cell recognition and the regulation of cell behavior. See OMIM entries 300137 and 147100. While constructing a YAC/STS map of the human X chromosome, Mazzarella et al., Genomics 48: 157-162 (1998) (PubMed ID: 9521868) identified a region that was highly conserved between the human and hamster genomes. Using a PCR-based approach, they isolated cDNAs corresponding to this region from a teratocarcinoma cell line library. The cDNAs encoded a predicted 1,327-amino acid protein that was designated ‘immunoglobulin superfamily member 1’ (IGSF1) because it contained 12 Ig-like domains of the C2 (constant region type 2) type. In addition, IGSF1 has a signal sequence and a potential transmembrane domain. Northern blot analysis revealed that IGSF1 was expressed as a 4.7-kb mRNA in many of the tissues tested, with the highest expression in pancreas, testis, and fetal liver. Additional 2.8- and 5.5-kb transcripts were observed in heart and testis, respectively. Independently, Nagase et al., DNA Res. 4: 141-150 (1997) (PubMed ID: 9205841) isolated a human brain cDNA (GenBank GENBANK AB002362) encoding IGSF1. Mazzarella et al. (1998) reported that the IGSF1 gene is located 0.5 Mb proximal to HDGF on Xq25, and is transcribed from centromere to telomere. Using a computer mapping approach Frattini et al., Genomics 38: 87-91 (1996) (PubMed ID : 8954785)), Frattini et al. (1998) mapped the IGSF1 gene to Xq25. See Frattini et al., Gene 214: 1-6 (1998) (PubMed ID:9729118).

In addition, Frattini et al. (1998) identified the IGDC1 gene (GenBank GENBANK Y10523), which encodes a member of the immunoglobulin-like domain-containing molecule superfamily. The 1,336-amino acid IGDC1 protein contains 12 Ig-like domains in 2 clusters of 5 and 7 motifs, which are followed by a linker segment, and a transmembrane domain and a cytoplasmic region, respectively. The IGDC1 gene is conserved in mammals and is expressed in muscle, heart, brain, testis, and pancreas as transcripts of different lengths, suggesting that it is subjected to alternative splicing. The IGDC1 gene contains 19 exons distributed along approximately 20 kb; each Ig-like domain is encoded by a discrete exon which constitutes, either singly or multiply, the unit of repeated genomic duplications. The function of this gene was unknown. In spite of its hom*ology to natural killer (NK) cell inhibitory receptors, Frattini et al. (1998) were unable to demonstrate any expression of IGDC1 in purified NK cell populations or cell lines. This sequence similarity was intriguing, as the IGDC1 gene could have been involved in the pathogenesis of Xq25-linked lymphoproliferative disease (LYP), which presents with a defect in NK cell function.

The IGDC1 gene was recently identified by a computer-based approach (Frattini et al., 1996) aimed at the identification of genes possibly involved in LYP; however, mapping data suggested that it does not fall into the deletions described in patients affected by this disorder. However, it remained to be established whether it may be involved in the pathogenesis of other diseases mapped to Xq25, such as panhypopituitarism or Pettigrew syndrome

Additionally, NOV1 shares some identity with the Drosophila dumbfounded protein, which is a myoblast attractant that is essential for fusion. Aggregation and fusion of myoblasts to form myotubes is essential for myogenesis in many organisms. In Drosophila, the formation of syncytial myotubes is seeded by founder myoblasts. Founders fusion with clusters of fusion-competent myoblasts. The gene dumbfounded (duf) is required by myoblast aggregation and fusion. Duf encodes a member of the immunoglobulin superfamily of proteins that is an attractant for fusion-competent myoblasts. It is expressed by founder cells and serves to attract clusters of myoblasts from which myotubes form by fusion. See Ruiz-Gomez et al., Cell 102(2): 189-98 (2000).

NOV1b is potentially involved in tumorgenesis, including cell migration and invasion as well as metastatic potential. Therapeutic targeting of NOV1b with a monoclonal antibody is anticipated to limit or block the extent of tumor cell migration, invasion, and tumor metastasis, preferably in melanoma tumors.

The nucleic acids and proteins of NOV1 are useful in potential therapeutic applications implicated in various pathological disorders, described further below. For example, a cDNA encoding the NOV1 protein may be useful in gene therapy and may be useful when administered to a subject in need thereof.

The nucleic acids and proteins of the invention have applications in the diagnosis and/or treatment of various diseases and disorders. For example, the compositions of the present invention will have efficacy for the treatment of patients suffering from various tumors and cancers as well as other diseases, disorders and conditions.

The polypeptides can be used as immulnogens to produce antibodies specific for the invention, and as vaccines. They can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding the NOV1 protein may be useful in gene therapy, and the receptor-like protein may be useful when administered to a subject in need thereof. The novel NOV1 nucleic acid, and the NOV1 protein of the invention, or fragments thereof, may further be useful in diagnostic applications, wherein the presence or amount of the nucleic acid or the protein are to be assessed. These materials are further useful in the generation of antibodies that bind immunospecifically to the novel substances of the invention for use in therapeutic or diagnostic methods. These antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the “Anti-NOVX Antibodies” section below. For example the disclosed NOV1b protein has multiple hydrophilic regions, each of which can be used as an immunogen.

In one embodiment, a contemplated NOV1 a epitope is from about amino acids 10 to 110. In another embodiment, a NOV1 a epitope is from about amino acids 150 to 200. In additional embodiments, NOV1 a epitopes are from about amino acids 220 to 280, 290 to 325, 350 to 400, 420 to 430, 480 to 515, 550 to 560, 605 to 650, and from amino acids 660 to 841. Similarly, a contemplated NOV1b epitope is from about amino acid 25 to about amino acid 60. In additional embodiments, NOV1b epitopes are from about amino acids 65 to 110, 150 to 190, 240 to 275, and 280 to 334.

This novel protein also has value in development of powerful assay system for functional analysis of various human disorders, which will help in understanding of pathology of the disease and development of new drug targets for various disorders.

Expression data for NOV1 are included in Example 1.

NOV2

NOV2 is a novel LDL Receptor-like protein and nucleic acid encoding it.

NOV2 was originally cloned from pancreas and thyroid gland tissues, which were also used to express identifiable SeqCalling™ fragments of NOV2.

The similarities to the low-density lipoprotein receptor family domain class A and the CUB domain indicate that the NOV2 sequence has properties similar to those of other proteins known to contain these domains.

NOV2 has extensive hom*ology with multiple LDL receptor related proteins from different organisms, including the human LDL receptor-related protein 3 (LRP-3), the mouse LDL receptor-related protein 10, the rat LDL receptor-related protein, and human TANGO 136 protein. Accordingly, NOV2 is a novel member of the LDL receptor family, which includes LDLR, LRP-2, LRP-3, LRP-5, LRP-6, and LR8B. Members of this family are endocytic receptors that bind and internalize ligands from the circulation and extracellular space. Thus, NOV2 has utility in that it functions similarly to other members of the low density lipoprotein receptor family.

LDL receptors binds plasma lipoproteins that contain apolipoprotein B-100 (apoB-100) or apoE on their surface. LDL receptor is critical for the uptake of these lipoproteins, and mutations in LDL receptor are the cause of familial hypercholesterolemia, a disorder characterized by high levels of cholesterol-rich LDL in the plasma. The elevation of plasma cholesterol levels in patients afflicted with familial hypercholesterolemia leads to atherosclerosis and increased risk for myocardial infarction. NOV2 potentially plays a role in disorders of lipoprotein metabolism and transport, e.g., cardiovascular diseases such as atherosclerosis. Accordingly, NOV2 nucleic acids, proteins and NOV2 antagonists and agonists are useful for treatment of disorders of lipoprotein metabolism and transport, e.g., cardiovascular diseases such as atherosclerosis. For example, a cDNA encoding the NOV2 protein may be useful in gene therapy, and the NOV2 protein may be useful when administrated to a subject in need thereof.

In vitro studies have shown that LRP-2 is capable of binding and mediating the cellular uptake of a large number of different ligands including apoE-enriched very low density lipoproteins (Willnow et al. (1992) J. Biol. Chem. 267:26172-26180), complexes of urokinase plasminogen activator and plasminogen activator inhibitor-1 (tPA:PAI-1) (Willnow et al., supra), lipoprotein lipase (Willnow et al., supra), and lactoferrin. A receptor associated protein known as RAP (Orlando et al. (1992) Proc. Natl. Acad. Sci. 89:6698-6702) inhibits the binding of these ligands to LRP-2. Some or all of these ligands may bind NOV2. Accordingly, NOV2 nucleic acids, polypeptides, antagonists and agonists are useful for treatment of clotting disorders, e.g., inhibiting clot formation or dissolving clots.

A few specific and physiologically relevant ligands for LRP-2 have been identified, including apolipoprotein J (apoJ)/clusterin (Kounnas et al. (1995) J. Biol. Chem. 22: 13070-13075) and thyroglobulin (Zheng et al. (1998) Endocrinology 139:1462-1465). ApoJ has been reported to bind several proteins, including the βA4 peptide of the Alzheimer's precursor protein, a subclass of high density lipoprotein, and the complement membrane attack complex C5-C9 (Kounnas et al., supra). The clearance of apoJcomplexed with these and other molecules is expected to occur via LRP-2. Thus, LRP-2 may play an important functional role in the clearance of these complexes. For example, LRP-2 may function to target lipoproteins for clearance or may inhibit the cytolytic activity of the complement membrane C5b-C9 by clearing the apoJ/C5b-C9 complex. The fact that LRP-2 can bind the apoJ/amyloid-B complex suggests that LRP-2 may be involved in regulating the pathogenesis of Alzheimer's disease. A role for LRP-2 in Alzheimer's disease is further supported by another study that showed that LRP-2 may be involved in transporting the apoJ/amyloid 13 complex across the blood-brain-barrier (Zlokovic et al. (1996) Proc. Natl. Acad. Sci. 93:422904234). Thus, NOV2 nucleic acids, proteins, agonists and antagonists are useful for the treatment of Alzheimer's disease and other neurodegenerative disorders, e.g., Huntington's disease and Parkinson's disease.

LRP-2 is involved in participating in the endocytosis of thyroglobulin, which results in the release of thyroid hormones (Zheng et al. (1998) Endocrinology 139:1462-65). NOV2 may also be involved in the regulating the release of thyroid hormones. Thus, NOV2 nucleic acids, proteins, agonists, and antagonists are useful for the treatment of thyroid disorders, e.g., thyroid hormone release disorders.

LRP-2 is also predicted to play a role as a drug receptor and is thought to be involved in the uptake of polybasic drugs, e.g., aprotinin, aminoglycosides and polymyxin B. The uptake of polybasic drugs can be toxic, e.g., the administration of aminoglycosides is often associated with nephro- and ototoxicity. NOV2 may also mediate uptake of polybasic drugs, and NOV2 nucleic acids, proteins, agonists and antagonists are useful for the modulating the uptake of such drugs. NOV2 can also be used to design less toxic versions of such drugs.

In addition, LRP-2 is involved in the pathogenesis of Heymann Nephritis nephropathy (HN), an autoimmune glomerular disease, which is similar to human membranous nephropathy. It is thought that LRP-2 is the major pathogenic antigen and forms an antigen-antibody complex between the glomerular basem*nt membrane and the foot processes of glomerular epithelial cells. The presence of the antigen-antibody complex leads to extensive damage of the basem*nt membrane and proteinuria (Farquhar et al. (1994) Ann. N.Y Acad. Sci. 97-106). Similar to LRP-2, NOV2 may play a pathogenic role in autoimmune glomerular disease. Thus, NOV2 nucleic acids, proteins, agonists and antagonists are useful for the treatment of autoimmune glomerular disease.

LRP-5 and LRP-6 are thought to function in endocytosis. Based on genetic evidence, LRP-5 and possibly LRP-6 are thought to play a role in the molecular pathogenesis of type I diabetes (Brown et al. (1998) Biochem. Biophys. Res. Comm. 248:879-888). NOV2 is also likely to play a role in type I diabetes. Thus, NOV2 nucleic acids, proteins, agonists and antagonists are useful for the treatment of type I diabetes.

LR8B is expressed in brain and might be involved in brain-specific lipid transport. Brain-specific lipid transport may involve apoE4, which is associated with Alzheimer's disease. NOV2 may also be involved in brain-specific lipid transport, and NOV2 nucleic acids, proteins, agonists and antagonists are useful for the treatment of Alzheimer's disease.

In general, the NOV2 compositions of the present invention will have efficacy for treatment of neurological disorders, e.g., neurodegenerative disorders and neuropsychiatric disorders. Examples of neurodegenerative disorders include Alzheimer's disease, Parkinson's disease, and Huntington's disease. Examples of neuropsychiatric disorders include schizophrenia, attention deficit disorder, unipolar affective (mood) disorder, bipolar affective (mood) disorders (e.g., severe bipolar affective disorder (BP-I) and bipolar affective disorder with hypomania and major depression (BP-II)), and schizoaffective disorders. Other LDL-receptor related diseases and disorders are contemplated.

In addition to the hom*ology to the LDL receptor-related proteins, the NOV2 protein also has extensive hom*ology to the Breast and Ovarian Cancer Associated Antigen protein (from the Patp result), and to a potential human tumor suppressor protein (from the Blast result). Accordingly, the NOV2 compositions of the present invention will have efficacy for treatment of cancer, particularly breast and ovarian cancer.

The novel nucleic acid encoding NOV2, and the NOV2 protein of the invention, or fragments thereof, may further be useful in diagnostic applications, wherein the presence or amount of the nucleic acid or the protein are to be assessed. These materials are further useful in the generation of antibodies that bind immunospecifically to the novel substances of the invention for use in therapeutic or diagnostic methods and other diseases, disorders and conditions of the like. These materials are further useful in the generation of antibodies that bind immunospecifically to the novel substances of the invention for use in therapeutic or diagnostic methods. These antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the “Anti-NOVX Antibodies” section below.

For example, the disclosed NOV2 protein has multiple hydrophilic regions, each of which can be used as an immunogen. In one embodiment, a contemplated NOV2 epitope is from about amino acids 310 to 360. In another embodiment, a NOV2 epitope is from about amino acids 380 to 430. In additional embodiments, a NOV2 epitope is from about amino acids 520 to 600. In a further embodiment, a NOV2 epitope is from about amino acids 600 to 625. These novel proteins can also be used to develop assay systems for functional analysis.

NOV3

NOV3 is a novel small inducible cytokine family protein and nucleic acid encoding it.

Human tissues express identifiable SeqCalling™ fragments of NOV3 include NHFLS, HCN and HFLSRA.

NOV3 has two IL8-like domains (amino acids 36 to 88 and amino acids 132 to 154). Table 3F depicts the alignment of the cL8-like domains of NOV3 with a IL8 consensus sequence (SEQ ID NO:61).

As the BLAST result indicates, NOV3 protein shows good hom*ology with GRO proteins, including GRO1/Gro.alpha, GRO2/Gro.beta and GRO3/Gro/.Gamma. The GRO genes belong to a gene super-family which encodes a set of related small inducible cytokines that includes NAP-1/IL-8 (hereinafter IL-8/GRO gene family) (Matsushima, K., et al., 1988, J. Exp. Med., 167:1883-1893; Schmid, J., et al., 1987, J. of Immunol., 139:250-256; Peveru, P., et al., 1988, J. Exp. Med., 167:1547-1559), and platelet basic protein (PBP). PBP is the precursor of connective tissue activating protein III (CTAP IlI), .beta.-thromboglobulin (Castor, C. W., et al., 1983, Proc. Nat. Acad. Sci., 80:76-769), platelet factor 4 (PF4) (Deuel, T. F, et al. 1977, Proc. Nat. Acad. Sci. 74:2256-2258), .gamma.-interferon-inducible peptide (.gamma.IP-10) (Luster, A. D., et al., 1985, Nature (London), 315:672-676), and macrophage inflammatory protein 2 (MIP-2) (Wolpe, S. D., et al., 1989, PNAS (USA), 86:612-616).

GRO1 was initially identified by its constitutive over-expression in spontaneously transformed Chinese hamster fibroblasts (Anisowicz, A., et al., 1987, PNAS , 84:7188-7192). A related gene was identified in v-src transformed chicken cells (Sugano, S., et al., 1987, Cell, 49:321-328; Bedard, P. A., et al., 1987, PNAS (USA), 84:6715-6719). In expression studies with normal fibroblasts, Gro showed early response kinetics similar to c-fos, leading to the name Gro (growth regulated) (Anisowicz, et al., 1987, supra). Later, a protein with melanoma stimulating activity (MGSA) (Richmond, A., et al., supra) was shown to be encoded by GRO1, and sequence similarity was reported with the murine early response gene KC (Oquendo, P., et al., 1989, J. Biol. Chem., 264:4133-4137).

Preliminary studies showed that the Gro ax gene was expressed in active ulcerative colitis disease, but not in the inactive tissue. (Isaacs, K., et al., “Profiles of cytokine activation in inflammatory bowel disease tissue: measurement of cDNA amplification”, American Gastroenterological Assoc. & American Assoc. for the Study of Liver Diseases, May 13-16, 1990, Texas (Abstract)). On the other hand, disparity in expression of the Gro .alpha. gene was less in the case of active versus inactive tissues from Crohn's disease. The expression of the Gro .alpha. gene in active intestinal inflammation suggests a role of these cytokines in the pathogenesis of inflammatory bowel disease. In addition, GRO genes exhibit differential expression patterns in various tumor cells compared to their normal counterparts. For example, Gro.gamma. was found in colonic epithelial tumor cells but not in adjacent normal epithelial cells. It has also been observed that Gro alpha. is over-expressed in other tumor cell lines such as CHEF/16 cells, src-transformed chicken fibroblasts, and human melanomas. See U.S. Pat. No. 5,994,060 Example 1. On the other hand, it has also been observed that Gro alpha. is expressed in normal growing mammary cells but was absent in many carcinomas (Anisowicz, A. et al., 1988, Proc. Nat. Acad. Sci. supra.). Thus, depending on the cell and tumor types in question, a tumor treatment regimen would involve varying the amount of Gro.beta. or .gamma. accessible to the cells. This can be achieved by either increasing or decreasing the amounts of the GRO proteins available to the cells, depending on whether the tumorigenesis is due to their over- or under- expression of the GRO genes.

The similarity information for the NOV3 protein and nucleic acid disclosed herein suggest that NOV3 is a novel member of the IL8/GRO protein family. The result of domain analysis that NOV3 contains two IL-8-like domains further demonstrates that NOV3 is a novel member of the IL8/GRO protein family. Consequently, NOV3 nucleic acids, proteins, agonists and antagonists may have potential diagnostic and therapeutic utilities in various diseases and disorders that involve IL-8/Gro family genes and/or other related pathologies, including but not limited to Crohn's disease, inflammatory bowel disease, ulcerative colitis and various types of cancers, specifically colon cancer. For example, a cDNA encoding the NOV3 protein may be useful in gene therapy, and the NOV3 protein may be useful when administered to a subject in need thereof.

In addition, several members of the IL8/GRO family of proteins were shown to have neutrophil activating functions. IL-8 was the first one to be identified to have potent neutrophil activating function. Walz, A. et al., Biochem. Biophys. Res. Commun. 149:755 (1987), Schroder, J. M. et al., Immunol. 139:3474 (1987), Yoshimura, T. et al., Proc. Natl. Acad. Sci. U.S.A. 84:9233 (1987) and Baggiolini, M. et al., J. Clin. Invest. 84:1045 (1989). Subsequently, two other proteins of this family, neutrophil-activating peptide 2 (NAP-2) and Gro.alpha. were demonstrated to have similar biological activities on human neutrophils. Walz, A. and M. Baggiolini, Biochem. Biophys. Res. Commun. 159:969 (1989), Walz, A. and M. Baggiolini, J. Exp. Med. 171:449 (1990), Richmond, A. et al., EMBO J. 7:2025 (1988), Moser, B. et al., J. Exp. Med. 171:1797 (1990) and Schroder, J.-M. et al., J. Exp. Med. 171:1091 (1990).

Because of the extensive sequence similarity of NOV3 with GRO proteins, NOV3 is also likely to have the function of neutrophil activation. Thus, the nucleic acids and proteins of NOV3 are useful in therapeutic applications implicated in various neutrophil deficient pathological disorders in mammals, preferably humans. More specifically, NOV3, like other neutrophil-activating proteins, will be useful in the treatment of conditions which are accompanied or caused, locally or systemically, by a modification of the number or activation state of the PMN (polymorphonuclear cells—neutrophils). An increase of the number or enhancement of the activation state of the PMN leads to clinical improvement in bacterial, mycoplasma, yeast, fungal, and in various vital infections.

By way of nonlimiting example, NOV3 nucleic acids and polypeptides will have efficacy for treatment of patients suffering from various disorders associated with abnormally high or low neutrophil count and/or generalized high/low neutrophil level, including, for example, inflammatory illnesses, hematopoietic deficits arising from chemotherapy or from radiation therapy and resulting disorders derived from the above conditions. NOV3 nucleic acids and polypeptides will also be useful in enhancing the success of bone marrow transplants and wound healing burn treatment. Other diseases and disorders involving neutrophil activation and disorders are contemplated.

In general, the NOV3 nucleic acids and protein are useful in potential diagnostic and therapeutic applications and as a research tool. These include serving as a specific or selective nucleic acid or protein diagnostic and/or prognostic marker, wherein the presence or amount of the nucleic acid or the protein are to be assessed, as well as potential therapeutic applications such as the following: (i) a protein therapeutic, (ii) a small molecule drug target, (iii) an antibody target (therapeutic, diagnostic, drug targeting/cytotoxic antibody), (iv) a nucleic acid useful in gene therapy (gene delivery/gene ablation), and (v) a composition promoting tissue regeneration in vitro and in vivo (vi) biological defense weapon. The polypeptides can also be used as immunogens to produce antibodies specific for the invention, and as vaccines. They can also be used to screen for potential agonist and antagonist compounds.

The novel nucleic acid encoding the NOV3 protein, or fragments thereof, may further be useful in diagnostic applications, wherein the presence or amount of the nucleic acid or the protein are to be assessed. These materials are further useful in the generation of antibodies that bind immunospecifically to the novel substances of the invention for use in therapeutic or diagnostic methods. These antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the “Anti-NOVX Antibodies” section below. For example, as mentioned above, the disclosed NOV3 protein has multiple hydrophilic regions, each of which can be used as an immunogen. The novel NOV3 protein can be used in assay systems for functional analysis of various human disorders, which will help in understanding of pathology of the disease and development of new drug targets for various disorders.

NOV4

NOV4 was originally cloned from brain, fetal brain, pregnant uterus and placental JAR cells. Additional human tissues express identifiable SeqCalling™ fragments of NOV4. These tissues include pooled adrenal gland, placenta, pooled uterus, BeWo pool and brain.

A BLAST search against public databases revealed that the disclosed NOV4 protein (SEQ ID NO:14) has 111 of 111 residues (100%) identical to an unnamed human protein (Gi|14328032|gb|AAH09232.1|AAH09232, E value=2e-31) that is similar to human G antigen 8. In addition, NOV4 also has hom*ology to human Melanoma Associated Antigen GAGE-8 (ACC:076087, 117 aa, Expect=2.7e-17, Score=212 (74.6 bits).

The similarity between the disclosed NOV4 and CCYPR-48, a human cell cycle and proliferation protein suggests that NOV4 may function as a member of a cell cycle and proliferation-like protein.

Cell division is the fundamental process by which all living things grow and reproduce. In unicellular organisms such as yeast and bacteria, each cell division doubles the number of organisms, while in multicellular species many rounds of cell division are required to replace cells lost by wear or by programmed cell death, and for cell differentiation to produce a new tissue or organ. Properly regulated cell division cycle is thus vital for many important biological processes, such as reproduction, differentiation and proliferation, apoptosis and aging and senescence. The consequences of defects in proper cell division cycle are diverse, depending on types of defects and types of cells in which the defects are located. For example, uncoordinated cell proliferation in many tissues can lead to formation of various forms of cancers. Not surprisingly, many oncoproteins are known to affect cell cycle controls, and many tumor-suppressor genes are also involved in regulating cell proliferation. For another example, defects in triggering apoptosis in immune cells that fail to distinguish self molecules from foreign molecules can lead to autoimmune disorders. In addition, failure to induce apoptosis in tumor cells and virus-infected cells may render an organism susceptible to tumors and infections.

Extensive sequence similarity exists between NOV4 and CCYPR-48, which is expressed in developmental tissues, suggesting that NOV4 may play a role in immune, developmental and cell signaling disorders, and cell proliferative disorders including cancer.

In addition, NOV4 is hom*ologous to human Melanoma Associated Antigen GAGE-8. Many human tumors express antigens that are recognized in vitro by cytolytic T lymphocytes (CTLs) derived from the tumor-bearing patient. The GAGE (G antigen) gene family members encode such antigens. See OMIM 604132.

Taken together, the nucleic acids and proteins of NOV4 may be useful in potential therapeutic applications implicated in various immune, developmental and cell signaling disorders, and cell proliferative disorders including cancer. For example, a cDNA encoding the cell cycle and proliferation-like protein may be useful in gene therapy, and the cell cycle and proliferation-like protein may be useful when administered to a subject in need thereof. In the treatment of disorders associated with increased cell cycle and proliferation protein expression or activity, it is desirable to decrease the expression or activity of NOV4. In the treatment of disorders associated with decreased cell cycle and proliferation protein expression or activity, it is desirable to increase the expression or activity of NOV4. Therefore, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications and as a research tool. These include serving as a specific or selective nucleic acid or protein diagnostic and/or prognostic marker, wherein the presence or amount of the nucleic acid or the protein are to be assessed, as well as potential therapeutic applications such as the following: (i) a protein therapeutic, (ii) a small molecule drug target, (iii) an antibody target (therapeutic, diagnostic, drug targeting/cytotoxic antibody), (iv) a nucleic acid useful in gene therapy (gene delivery/gene ablation), and (v) a composition promoting tissue regeneration in vitro and in vivo (vi) biological defense weapon.

The NOV4 compositions of the present invention will have efficacy for treatment of patients suffering from, for example, immune disorders, developmental disorders, cell-signaling disorders, cell proliferative disorders and cancers. Other pathologies and disorders are contemplated.

The novel nucleic acid encoding a cell cycle and proliferation-like protein, and the cell cycle and proliferation-like protein of the invention, or fragments thereof, may further be useful in diagnostic applications, wherein the presence or amount of the nucleic acid or the protein are to be assessed. These materials are further useful in the generation of antibodies that bind immunospecifically to the novel substances of the invention for use in therapeutic or diagnostic methods and other diseases, disorders and conditions of the like. These materials are further useful in the generation of antibodies that bind immunospecifically to the novel substances of the invention for use in therapeutic or diagnostic methods. These antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the “Anti-NOVX Antibodies” section below.

For example, the disclosed NOV4 protein has multiple hydrophilic regions, each of which can be used as an immunogen. In one embodiment, a contemplated NOV4 epitope is from about amino acids 8 to 25. In another embodiment, a NOV4 epitope is from about amino acids 25 to 65. In additional embodiments, NOV4 epitopes are from about amino acids 65 to 111. These novel proteins can also be used to develop assay system for functional analysis.

NOV5

NOV5 was originally cloned from fetal kidney tissue. Additional human tissues express identifiable SeqCalling™ fragments of NOV5. These tissues include bone, NHFLS, HCN, HFLSRA, kidney bone marrow, HFDPC, hair follicles, salivary gland, and NHMC-RM.

NOV5 is a cadherin-like protein. Cadherins are calcium-dependent adhesive proteins that mediate cell-to-cell interaction. See, e.g., Online Mendelian Inheritance in Man (“OMIM”) Identity. No. 601120 at URL http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM. Cadherins constitute an expanding family of receptors involved in the structural and functional organization of cells in various tissues. See, e.g., Huber et al., 1996 Genomics 32: 21-28. Members of the family include epithelial cadherin (E-cadherin; OMIM ID. 192090), neural cadherin (N-cadherin; OMIM ID. 114020), placental cadherin (P-cadherin; OMIM ID. 114021), muscle cadherin (M-cadherin; OMIM ID. 114019), and vascular endothelial cadherin (VE-cadherin, or CDH5). Family members share a common domain structure and primary sequence hom*ologies. Each cadherin type has a unique tissue-distribution pattern. In addition, multiple cadherin types may be found at the surface of a particular cell. See, e.g., Salomon et al., 1992 J. Cell Sci. 102: 7-17.

The full NOV5 amino acid sequence of the protein of the invention has 1102 of 1135 amino acid residues (97%) identical to, and positive with, the 1136 amino acid residue KIAA1562 protein from hom*o sapiens (gi|10047189|dbj|BAB13388.1|(AB046782)) (E=0.0). Further, the NOV5 polypeptide has 679 of 709 amino acid residues (95%) identical to, and 676 of 709 residues (95%) positive with, the 709 amino acid residue DKFZp434B0923.1 hypothetical protein from hom*o sapiens ( gi|1359910|pir||T46413) (E=0.0); and 71 of 242 amino acid residues (29%) identical to, and 116 of 242 residues (47%) positive with, a second hypothetical protein from hom*o sapiens (gi|6808080|emb|CAB70755.1|(AL137471)) (E=2e⁻²¹). NOV5 protein has 390 of 1044 amino acid residues (37%) identical to, and 577 of 1044 residues (54%) positive with, the 1044 amino acid residue OL-protocadherin protein isoform from Mus musculus (gi|14210851|gb|AAK57195.1|AF334801_—1(AF334801)) (E=1e⁻¹⁸⁰) where Gaps=129/1044 (12%). NOV5 protein has 390 of 1038 amino acid residues (37%) identical to, and 574 of 1038 residues (54%) positive with, the 1093 amino acid residue KIAA1400 protein from hom*o sapiens ( gi|7243181|dbj|BAA92638.1|(AB037821)) (E=1e⁻¹⁷⁹), where Gaps=129/1038 (12%). NOV5 protein has 1135 of 1135 amino acid residues (100%) identical to, and positive with, the 1135 amino acid residue qs14_—3 protein sequence from hom*o sapiens (PCT Publication WO200009552-A1; patp accno:AAY94923) (E=0.0). NOV5 protein has 460 of 461 amino acid residues (99%) identical to, and positive with, the 461 amino acid residue vc35_—1 protein from hom*o sapiens (PCT Publication WO200011015-A1; patp accno: AAY94991) (E=7.0e⁻²⁴⁹).

Any reference to NOV5 is assumed to encompass all variants.

DOMAIN results for NOV5 were collected from the Conserved Domain Database (CDD) with Reverse Position Specific BLAST. This BLAST samples domains found in the Smart and Pfam collections. The results for NOV5 are listed in Table 5E with the statistics and domain description.

Cadherins are a family of animal glycoproteins responsible for calcium-dependent cell-cell adhesion. See, e.g., Takeichi 1987 Trends Genet. 2: 213-217; Takeichi 1990 Annu. Rev. Biochem. 59: 237-252. Cadherins preferentially form hom*omeric complexes between connecting cells; thus acting as both receptor and ligand. Several different isoforms are distributed in a tissue-specific manner in a wide variety of organisms. Cells containing different cadherins tend to segregate in vitro, while those that contain the same cadherins tend to preferentially aggregate together. This observation is linked to the finding that cadherin expression causes morphological changes involving the positional segregation of cells into layers, suggesting they may play an important role in the sorting of different cell types during morphogenesis, histogenesis and regeneration. They may also be involved in the regulation of tight and gap junctions, and in the control of intercellular spacing. Cadherins are evolutionarily related to the desmogleins, which are components of intercellular desmosome junctions involved in the interaction of plaque proteins.

Cadherins are glycoproteins involved in Ca²⁺-mediated cell-cell adhesion. Cadherin domains occur as repeats in the extracellular regions that are thought to mediate cell-cell contact when bound to calcium. Structurally, cadherins comprise a number of domains: these include a signal sequence; a propeptide of around 130 residues; an extracellular domain of around 600 residues; a single transmembrane domain; and a well-conserved C-terminal cytoplasmic domain of about 150 residues. The extracellular domain can often be subdivided into 5 parts, 4 of which are repeats of about 110 residues, and the fifth contains 4 conserved cysteines. This pattern is thought to include two conserved aspartic acid residues as well as two asparagines. See, generally the PROSITE entries PDOC00205, PS00232, PS50268, available at http://expasv.ch, and InterPro entries IPR000233 and IPR002126 available at http://wwv.ebi.ac.uk/interpro. The calcium-binding region of cadherins is thought to be located in the extracellular domain.

Included in this family are DSG2human: Desmoglein 2 (SwissProt No. Q14126); CADF_human: Muscle (M-cadherin) (CDHI4) (SwissProtNo. P55291); CADD_human: T-cadherin (truncated cadherin) (CDH13) (SwissProt No. P55290); CAD5_human: Vascular endothelial (VE-cadherin) (CDH5) (SwissProt No. P33151); CAD3_human: Placental (P-cadherin) (CDH3) (SwissProt No. P22223); DSG3_human: Desmoglein 3 (Pemphigus vulgaris antigen) (SwissProt No. P32926); CADC_human: Brain (BR-cadherin) (CDH12) (SwissProt No. P55289); CADB_human: Osteoblast (OB-cadherin) (CDH11) (SwissProt No. P55287); CAD8_human: Cadherin-8 (CDH8) (SwissProt No. P55286); CAD6_human: Kidney (K-cadherin) (CDH6) (SwissProt No. P55285); CAD4_human: Retinal (R-cadherin) (CDH4) (SwissProt No. P55283); CADH_rat: Liver-intestine (LI-cadherin) (SwissProt No. P55281); CADF_Xenopus laevis: EP-cadherin (SwissProt No. P33148); CAD1_human: Epithelial (E-cadherin) (a.k.a. uvomorulin or L-CAM) (CDH1) (SwissProt No. P12830); DSG1_human: Desmoglein 1 (desmosomal glycoprotein 1) (SwissProt No. Q02413); and CAD2_HUMAN: Neural (N-cadherin) (CDH2) (SwissProt No. P19022).

The nucleic acids and proteins of NOV5 have biological activities that would make them suitable for treating, preventing or ameliorating medical conditions in humans and animals; and so are useful in potential therapeutic applications implicated in various pathological disorders, described further below. For example, a cDNA encoding the cadherin-like protein is useful in gene therapy, and the vascular cadherin-like protein is useful when administered to a subject in need thereof. The NOV5 polynucleotides can be used as markers for tissues in which the protein is preferentially expressed, as molecular weight markers on Southern gels. NOV5 nucleic acid sequences of the invention can be used as chromosome markers or tags to identify chromosomes or to map gene positions, and as a source of diagnostic primers and probes.

The secreted NOV5 proteins of the invention include those that are thought to be only partially secreted, i.e., transmembrane proteins. The proteins of the invention may exhibit one or more activities selected from the following: cytokine activity; cell proliferation; virucide; antibacterial; antifungal; anti-inflammatory; dermatological; antidiabetic; antiasthmatic; antiarthritic; antirheumatic; protozoacide; antithyroid; tumor inhibitor; growth stimulant, hematopoietic stimulant; contraceptive; differentiation; immune modulation (i.e., immunostimulant; immunosuppressant); haematopoiesis regulation; tissue growth modulatory activity; activin/inhibin activity; chemotactic/chemokinetic activity; haemostatic and thrombolytic activity; anti-inflammatory activity; and tumor inhibition activity. The proteins may be administered to patients as vaccines, and the nucleotides may be used as part of a gene therapy regime.

NOV5 can be used in the treatment of immune deficiencies and disorders, such as severe combined immunodeficiency (SCID), as well as viral, bacterial, fungal and other infections. These infections include human immunodeficiency virus (HIV), hepatitis, herpes viruses, mycobacteria, Leismania species, malaria and candidiasis. NOV5 proteins can be used to treat autoimmune disorders such as connective tissue disease, multiple sclerosis, systemic lupus erythematosis, rheumatoid arthritis, autoimmune pulmonary inflammation, Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes mellitus, myasthenia gravis, graft-versus-host-disease and autoimmune inflammatory eye disease. NOV5 proteins can also be used to treat allergic conditions, such as asthma and anemia. NOV5 proteins can additionally be used to treat cancer; cardiovascular disorders; blood disorders; hemophilia; neurodegenerative disease; genetic disorders; hemophilia; cardiovascular diseases; cancer; bacterial, fungal and viral infections, especially HIV. In various further embodiments, NOV5 can be used for treating wounds, burns, ulcers, osteoporosis, osteoarthritis, periodontal diseases, Alzheimer's disease, Parkinson's disease, Huntington's disease and amyotrophic lateral sclerosis (“ALS”). NOV5 proteins with activin/inhibin activity may additionally be useful as contraceptives.

The polypeptides can be used as immunogens to produce antibodies specific for the invention, and as vaccines. They can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding the cadherin-like protein may be useful in gene therapy, and the receptor-like protein may be useful when administered to a subject in need thereof. The novel nucleic acid encoding cadherin-like protein, and the cadherin-like protein of the invention, or fragments thereof, may further be useful in diagnostic applications, wherein the presence or amount of the nucleic acid or the protein are to be assessed. These materials are further useful in the generation of antibodies that bind immunospecifically to the novel substances of the invention for use in therapeutic or diagnostic methods. These antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the “Anti-NOVX Antibodies” section below. For example the disclosed NOV5 protein has multiple hydrophilic regions, each of which can be used as an immunogen. in one embodiment, a contemplated NOV5 epitope is from about amino acids 10 to 40. In another embodiment, a NOV5 epitope is from about amino acids 110 to 130. In additional embodiments, NOV5 epitopes are from amino acids 150 to 175, 190 to 200, 240-270 and from amino acids 280 to 320. This novel protein also has value in development of powerful assay system for functional analysis of various human disorders, which will help in understanding of pathology of the disease and development of new drug targets for various disorders.

Taqman data for NOV5 is included in Example 1.

NOV6

NOV 6 represents novel members of a family of related lysozyme C-1 precursor-like proteins, which are related to the glycoside hydrolase family. Included within NOV6 are four different family members designated NOV6a, NOV6b, NOV6c, and NOV6d. Each of these is discussed in detail below.

NOV6a 1-3

Disclosed herein are three related members of the NOV6 family, designated NOV6a1, NOV6b1, and NOV6c1. The nucleotide sequences of each of these NOV6as differ, but each of NOV6a 1, 2, and 3 code for the same protein. These sequences are discussed in detail below.

NOV6a1

NOV6a1 was initially identified by searching CuraGen's Human SeqCalling database for DNA sequences that translate into proteins with similarity to a protein family of interest. NOV6 a was derived by laboratory cloning of cDNA fragments covering the full length and/or part of the DNA sequence of the invention, and/or by in silico prediction of the full length and/or part of the DNA sequence of the invention from public human sequence databases. The laboratory cloning was performed using one or more of the methods summarized below:

SeqCalling™ Technology: cDNA was derived from various human samples representing multiple tissue types, normal and diseased states, physiological states, and developmental states from different donors. Samples were obtained as whole tissue, cell lines, primary cells or tissue cultured primary cells and cell lines. Cells and cell lines may have been treated with biological or chemical agents that regulate gene expression for example, growth factors, chemokines, or steroids. The cDNA thus derived was then sequenced using CuraGen's proprietary SeqCalling technology.

RACE: Techniques based on the polymerase chain reaction such as rapid amplification of cDNA ends (RACE) were used to isolate or complete the predicted sequence of the cDNA of the invention. Usually multiple clones were sequenced from one or more human samples, to derive the sequences for fragments. Human samples from different donors from testis and fetal brain were used for the RACE reaction.

Sequence traces were evaluated manually and edited for corrections if appropriate. Fragment sequences were assembled with other fragments derived by RACE and by SeqCalling and with public ESTs using bioinformatics programs and were included in CuraGen's human SeqCalling database of SeqCalling assemblies. Each assembly contains one or more overlapping cDNA sequences derived from one or more human samples. Fragments and ESTs were included as components for an assembly when the extent of identity with another component of the assembly was at least 95% over 50 bp. Each assembly can represent a gene and/or its variants such as splice forms and/or single nucleotide polymorphisms (SNPs) and their combinations.

SeqCalling assembly sequences were initially identified by searching CuraGen Corporation's Human SeqCalling database for DNA sequences which translate into proteins with similarity to LYSOZYME C-1 PRECURSOR and/or members of the LYSOZYME C-1 PRECURSOR family. One or more SeqCalling assemblies in 144861150 were identified as having suitable similarity. One or more of these assemblies were analyzed further to identify any open reading frames encoding novel full length proteins as well as novel splice forms of these genes. The resulting DNA sequence and protein sequence for a novel LYSOZYME C-1 PRECURSOR-like gene or one of its splice forms are reported here as CuraGen Ace. No. 5603288.0.20_da1, or NOV6a1.

The regions defined by all approaches were then manually integrated and manually corrected for apparent inconsistencies that may have arisen, for example, from miscalled bases in the original fragments used, or from discrepancies between predicted hom*ology to a protein of similarity to derive the final sequence of the NOV6a1 reported here. When necessary, the process to identify and analyze SeqCalling assemblies, ESTs and genomic clones was reiterated to derive the full length sequence.

The disclosed nucleic acid sequence has 263 of 420 nucleotides (62%) identical to a 603 base pair mRNA from Presbytis entellus (GENBANK-ID:PELYSOC|acc:X60235.1 mRNA P.entellus mRNA for lysozyme C), E value=3.5e-¹⁶).

The full amino acid sequence of the disclosed NOV6a protein was found to have 75 of 147 amino acid residues (51%) identical to, and 103 of 147 amino acid residues (70%) similar to, the 147 amino acid residue protein lysozyme C-I precursor protein from Anas platyrhynchos (domestic duck): ptnr:SWISSPROT-ACC:P00705 LYSOZYME C-1 PRECURSOR (EC 3.2.1.17) (1,4-BETA-N-ACETYLMURAMIDASE C), Expect=5.8e-40.

NOV6a2

NOV6a2 was initially identified by searching CuraGen's Human SeqCalling database for DNA sequences that translate into proteins with similarity to a protein family of interest.

The cDNA coding for the NOV6a2 (CG52754-03) sequence was cloned by the polymerase chain reaction (PCR) using the following primers: ACTATGGAAAATTTGAACACCAGTTC (SEQ ID NO:75) and CTATGCTGAGTCTGTGCTCCTG (SEQ ID NO:76). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain-amygdala, brain-cerebellum, brain-hippocampus, brain-substantia nigra, brain-thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma-Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus.

Multiple clones were sequenced and these fragments were assembled together, sometimes including public human sequences, using bioinformatic programs to produce a consensus sequence for each assembly. Each assembly is included in CuraGen Corporation's database. Sequences were included as components for assembly when the extent of identity with another component was at least 95% over 50 bp. Each assembly represents a gene or portion thereof and includes information on variants, such as splice forms single nucleotide polymorphisms (SNPs), insertions, deletions and other sequence variations.

The PCR product derived by exon linking, covering the entire open reading frame, was cloned into the pCR2.1 vector from Invitrogen to provide clone 123499::GMAC044846_A.698445.C13.

This nucleic acid sequence differs firom that of NOV6a1 by having 306 fewer nucleotides at the 5′ end, a base change from T to A (at position 812 of NOV6al or 506 of NOV6a2) and 95 fewer nucleotides at the 3′ end. The encoded NOV6a protein is the same.

The disclosed lysozyme c-1 precursor-like gene is expressed in at least the following tissues: cartilage, spleen, lung, kidney, white blood cells, plasma, saliva, milk and tears. Expression information was derived from the tissue sources of the sequences that were included in the derivation of the sequence of CuraGen Acc. No. CG52754-03.

The PSORT data suggests that theNOV6a2 lysozyme c-1 precursor-like protein may be localized at the plasma membrane and that the protein of CuraGen Acc. No. CG52754-03 is similar to the lysozyme c-1 precursor family, some members of which are secreted. Therefore it is likely that this protein is localized to the same sub-cellular compartment.

NOV6a3

NOV6a3 was identified by subjecting a previously identified clone, 30412306_—0_—100_dal (B), see NOV6d, below, to the exon linking process to confirm the sequence. PCR primers were designed by starting at the most upstream sequence available, for the forward primer, and at the most downstream sequence available for the reverse primer. In each case, the sequence was examined, walking inward from the respective termini toward the coding sequence, until a suitable sequence that is either unique or highly selective was encountered, or, in the case of the reverse primer, until the stop codon was reached. Such primers were designed based on in silico predictions for the full length cDNA, part (one or more exons) of the DNA or protein sequence of the target sequence, or by translated hom*ology of the predicted exons to closely related human sequences from other species. These primers were then employed in PCR amplification based on the following pool of human cDNAs: adrenal gland, bone marrow, brain-amygdala, brain-cerebellum, brain-hippocampus, brain-substantia nigra, brain-thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma-Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus. Usually the resulting amplicons were gel purified, cloned and sequenced to high redundancy. The resulting sequences from all clones were assembled with themselves, with other fragments in CuraGen Corporation's database and with public ESTs. Fragments and ESTs were included as components for an assembly when the extent of their identity with another component of the assembly was at least 95% over 50 bp. In addition, sequence traces were evaluated manually and edited for corrections if appropriate. These procedures provide the sequence reported below, which is designated Accession Number 30412306_—0_—100_dal (NOV6a3).

The cDNA coding for the sequence was cloned by polymerase chain reaction (PCR) using the following primers: TGACCTTGGCCACGCTGATG (SEQ ID NO:77) and TCAATTTTCACATGCATATCACACCCC (SEQ ID NO:78) on the following pools of human cDNAs: Pool 1—Adrenal gland, bone marrow, brain-amygdala, brain-cerebellum, brain-hippocampus, brain-substantia nigra, brain-thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma-Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus.

Primers were designed based on in silico predictions for the full length or part (one or more exons) of the DNA/protein sequence of the invention or by translated hom*ology of the predicted exons to closely related human sequences or to sequences from other species. Usually multiple clones were sequenced to derive the sequence which was then assembled similar to the SeqCalling process. In addition, sequence traces were evaluated manually and edited for corrections if appropriate.

Physical clone: The PCR product derived by exon linking was cloned into the pCR2.1 vector from Invitrogen. The bacterial clone 118885::30412306_—0_—100_dal.698324.C1 has an insert covering the entire open reading frame cloned into the pCR2.1 vector from Invitrogen.

This nucleic acid sequence differs from that of NOV6a1 by having 310 fewer nucleotides at the 5′ end and 110 fewer nucleotides at the 3′ end. The encoded NOV6a protein is the same.

The disclosed NOV6a3 Lysozyme C-1 Precursor-like protein is expressed in at least the following tissues: cartilage, spleen, lung, kidney, white blood cells, plasma, saliva, milk and tears. This information was derived by determining the tissue sources of the sequences that were included in the invention including but not limited to SeqCalling sources, Public EST sources, Literature sources, and/or RACE sources.

NOV6b

NOV6b is a novel member of the lysozyme C-1 precursor-like family of proteins, which are related to the glycoside hydrolase family. The cDNA coding for the NOV6b (5603288.0.1, CG52754-01) sequence was cloned by the polymerase chain reaction (PCR). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from fetal brain and kidney tissue.

Multiple clones were sequenced and these fragments were assembled together, sometimes including public human sequences, using bioinformatic programs to produce a consensus sequence for each assembly. Each assembly is included in CuraGen Corporation's database. Sequences were included as components for assembly when the extent of identity with another component was at least 95% over 50 bp. Each assembly represents a gene or portion thereof and includes information on variants, such as splice forms single nucleotide polymorphisms (SNPs), insertions, deletions and other sequence variations.

SeqCalling assemblies produced by the exon linking process were selected and extended using the following criteria. Genomic clones having regions with 98% identity to all or part of the initial or extended sequence were identified by BLASTN searches using the relevant sequence to query human genomic databases. The genomic clones that resulted were selected for further analysis because this identity indicates that these clones contain the genomic locus for these SeqCalling assemblies. These sequences were analyzed for putative coding regions as well as for similarity to the known DNA and protein sequences. Programs used for these analyses include Grail, Genscan, BLAST, HMMER, FASTA, Hybrid and other relevant programs.

Some additional genomic regions may have also been identified because selected SeqCalling assemblies map to those regions. Such SeqCalling sequences may have overlapped with regions defined by hom*ology or exon prediction. They may also be included because the location of the fragment was in the vicinity of genomic regions identified by similarity or exon prediction that had been included in the original predicted sequence. The sequence so identified was manually assembled and then may have been extended using one or more additional sequences taken from CuraGen Corporation's human SeqCalling database. SeqCalling fragments suitable for inclusion were identified by the CuraTools™ program SeqExtend or by identifying SeqCalling fragments mapping to the appropriate regions of the genomic clones analyzed. Such sequences were included in the derivation of NOV6b only when the extent of identity in the overlap region with one or more SeqCalling assemblies was high. The extent of identity may be, for example, about 90% or higher, preferably about 95% or higher, and even more preferably close to or equal to 100%. When necessary, the process to identify and analyze SeqCalling fragments and genomic clones was reiterated to derive the full length sequence.

The regions defined by the procedures described above were then manually integrated and corrected for apparent inconsistencies that may have arisen, for example, from miscalled bases in the original fragments or from discrepancies between predicted exon junctions, EST locations and regions of sequence similarity, to derive the final sequence disclosed herein. When necessary, the process to identify and analyze SeqCalling assemblies and genomic clones was reiterated to derive the full length sequence. The Seq Calling Fragments of the clone were provided by the following human tissues: 10 human total RNAs from Clonetech (brain, fetal brain, liver, fetal liver, skeletal muscle, pancreas, kidney, heart, lung, and placenta.

The DNA sequence for the disclosed lysozyme C-1 precursor-like gene is reported here as CuraGen Acc. No.5603288.0.1, CG52754-01, or NOV6b. The disclosed novel NOV6b nucleic acid of 646 nucleotides (SEQ ID NO:17) is shown in Table 6F. An open reading frame begins at nucleotide 83 and ends with at nucleotide 559.

The full amino acid sequence of the disclosed NOV6b protein was found to have 75 of 147 amino acid residues (51%) identical to, and 103 of 147 amino acid residues (70%) positive with, the 147 amino acid residue protein SWISSPROT-ACC:P00705 LYSOZYME C-1 PRECURSOR (EC 3.2.1.17) (1,4-BETA-N-ACETYLMURAMIDASE C)—Anas platyrhynchos (Domestic duck) (E value=1.0e-39). Additionally, NOV 6b has similarity with the amino acid sequence of bare-faced crassow lysozyme: Expect=2.7e-39 Identities=68/129 (52%); Positives=95/129 (73%) with PIR-ID:JE0185 lysozyme (EC 3.2.1.17)—bare-faced crassow A.

High scoring similarities with human proteins include: the 148 amino acid protein SPTREMBL-ACC:O75951 LYSOZYME hom*oLOG -Expect=1.4e-33, Identities=62/141 (43%), Positives=94/141 (66%).

NOV6c

NOV6c is a novel member of the lysozyme C-1 precursor-like family of proteins, which are related to the glycoside hydrolase family. The sequence coding for the NOV6c (CG52754-02) sequence was derived by laboratory cloning of cDNA fragments, by in silico prediction of the sequence. cDNA fragments covering either the full length of the DNA sequence, or part of the sequence, or both, were cloned. In silico prediction was based on sequences available in Curagen's proprietary sequence databases or in the public human sequence databases, and provided either the full length DNA sequence, or some portion thereof.

The cDNA coding for the CG52754-02 sequence was cloned by the polymerase chain reaction (PCR) using the primers: TCTGAGGCAATGAATGGAATGAATCAC (SEQ ID NO:79) and CCAAGCCATTTACAAAATCTTTGTAAAATGC (SEQ ID NO:80). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain-amygdala, brain-cerebellum, brain-hippocampus, brain-substantia nigra, brain-thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma-Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus.

Multiple clones were sequenced and these fragments were assembled together, sometimes including public human sequences, using bioinformatic programs to produce a consensus sequence for each assembly. Each assembly is included in CuraGen Corporation's database. Sequences were included as components for assembly when the extent of identity with another component was at least 95% over 50 bp. Each assembly represents a gene or portion thereof and includes information on variants, such as splice forms single nucleotide polymorphisms (SNPs), insertions, deletions and other sequence variations.

The PCR product derived by exon linking, covering the entire open reading frame, was cloned into the pCR2.1 vector from Invitrogen to provide clone 121210::GMAC055861_A.698425.C9.

NOV6c differs from NOV6a by a C147>V amino acid change and 12 fewer amino acids at the C terminus. The full amino acid sequence of the disclosed NOV6c protein was found to have 74 of 146 amino acid residues (50%) identical to, and 102 of 146 amino acid residues (69%) similar to, the 147 amino acid residue ptnr:SWISSPROT-ACC:P00705 protein from Anas platyrhynchos (Domestic duck) (LYSOZYME C-1 PRECURSOR (EC 3.2.1.17) (1,4-BETA-N-ACETYLMURAMIDASE C)), E=5.8 e-39.

The LYSOZYME C-1 PRECURSOR-like gene disclosed in this invention is expressed in at least the following tissues: cartilage, spleen, lung, kidney, white blood cells, plasma, saliva, milk and tears. Expression information was derived from the tissue sources of the sequences that were included in the derivation of the sequence of CuraGen Acc. No. CG52754-02, NOV6c.

NOV6d

NOV6d is a novel member of the lysozyme C-1 precursor-like family of proteins, which are related to the glycoside hydrolase family. The sequence coding for the disclosed NOV6d (30412306_—0_—100_dal(B)) was derived by laboratory cloning of CDNA fragments covering the full length and/or part of the DNA sequence of the invention, and/or by in silico prediction of the full length and/or part of the DNA sequence of the invention from public human sequence databases. The laboratory cloning was performed by the method(s) summarized below:

SeqCallingTM Technology: cDNA was derived from various human samples representing multiple tissue types, normal and diseased states, physiological states, and developmental states from different donors. Samples were obtained as whole tissue, cell lines, primary cells or tissue cultured primary cells and cell lines. Cells and cell lines may have been treated with biological or chemical agents that regulate gene expression for example, growth factors, chemokines, steroids. The cDNA thus derived was then sequenced using CuraGen's proprietary SeqCalling technology. Sequence traces were evaluated manually and edited for corrections if appropriate. cDNA sequences from all samples were assembled with themselves and with public ESTs using bioinformatics programs to generate CuraGen's human SeqCalling database of SeqCalling assemblies. Each assembly contains one or more overlapping cDNA sequences derived from one or more human sample(s). Fragments and ESTs were included as components for an assembly when the extent of identity with another component of the assembly was at least 95% over 50 bp. Each assembly can represent a gene and/or its variants such as splice forms and/or single nucleotide polymorphisms (SNPs) and their combinations.

The CDNA coding for the sequence was cloned by polymerase chain reaction (PCR) using the following primers: TGACCTTGGCCACGCTGATG (SEQ ID NO: 81) and TCAATTTTCACATGCATATCACACCCC (SEQ ID NO:82) on the following pools of human cDNAs: Pool 1—Adrenal gland, bone marrow, brain-amygdala, brain-cerebellum, brain-hippocampus, brain-substantia nigra, brain-thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma-Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus. Pool2—Cancer tissue pool and Pool 3—Developmental pool.

Primers were designed based on in silico predictions for the full length or part (one or more exons) of the DNA/protein sequence of the invention or by translated hom*ology of the predicted exons to closely related human sequences or to sequences from other species. Usually multiple clones were sequenced to derive the sequence which was then assembled similar to the SeqCalling process. In addition, sequence traces were evaluated manually and edited for corrections if appropriate.

The sequence identified by exon linking was extended in silico using information from at least some of the following sources: SeqCalling assemblies 144861150 144861122 144861127, and genomic clones gen:gb_AL356797 HTG hom*o sapiens|hom*o sapiens chromosome X clone RP11-404P16, 28 unordered pieces, 158749 bp splicing genomic regions: 39614-39602.

The full amino acid sequence of the protein of the invention was found to have 75 of 147 amino acid residues (51%) identical to, and 103 of 147 amino acid residues (70%) similar to, the 147 amino acid residue ptnr:SWISSPROT-ACC:P00705 protein from Anas platyrhynchos (Domestic duck) (LYSOZYME C-1 PRECURSOR (EC 3.2.1.17) (1,4-BETA-N-ACETYLMURAMIDASE C), E=5.8 e-40.

The disclosed NOV6d Lysozyme C-1 Precursor-like protein is expressed in at least the following tissues: cartilage, spleen, lung, kidney, white blood cells, plasma, saliva, milk and tears. This information was derived by determining the tissue sources of the sequences that were included in the invention, including literature references. In addition, the sequence is predicted to be expressed in the following tissues because of the expression pattern of GENBANK-ID: gb:GENBANK-ID:PELYSOC|acc:X6023 5, a closely related P. entellus mRNA for lysozyme c hom*olog in species Presbytis entellus.

The best hits from a BLASTP Non-Redundant Composite database include: the 147 amino acid protein, ptnr:SWISSPROT-ACC:P00705 LYSOZYME C-1 PRECURSOR (EC 3.2.1.17) (1,4-BETA-N-ACETYLMURAMIDASE C) from Anas platyrhynchos (Domestic duck). Expect=6.3e-40, Identities=75/147 (51%), Positives=103/147 (70%); the 129 amino acid protein ptnr:pir-id:JE0185 lysozyme (EC 3.2.1.17) from bare-faced crassow, Expect=1.7e-39, Identities=68/129 (52%), Positives=95/129 (73%); and the 147 amino acid protein ptnr:SWISSPROT-ACC:P00702 LYSOZYME C PRECURSOR (EC 3.2.1.17) (1,4-BETA-N-ACETYLMURAMIDASE C) from Phasianus colchicus (Ring-necked pheasant), Expect=5.6e-39, Identities=66/143 (46%), Positives=101/143 (70%).

The presence of identifiable domains in NOV6 was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/).

DOMAIN results for NOV6 were collected from the Conserved Domain Database (CDD) with Reverse Position Specific BLAST. This BLAST samples domains found in the Smart and Pfam collections. The results are listed in Table 6P and Table 6Q, with the statistics and domain description. The results indicate that this protein contains the lysozyme C domain from the alpha lactalbumin family. Amino acids 22-147 NOV6a align with amino acids 1-125 of the smart00263 domain, indicated in Table 6P as SEQ ID NO:89 Amino acids 22-147 NOV6a align with amino acids 1-122 of the pfam00062 domain, indicated in Table 6Q as SEQ ID NO:90.

The Interpro entry IPR001916; Lactalbmn_lysozyme (matches 173 proteins) corresponds to the Glycoside hydrolase family 22. Signature sequences include: PS00128; lactalbumin_lysozyme (149 proteins); PR00135; lyzlact (140 proteins); PF00062; lys (171 proteins); SM00263; LYZ1 (156 proteins); IPR000545; Lactalbumin (48 proteins); and IPR000974; Lysozyme (98 proteins). Glycoside hydrolase family 22 [http://afmb.cnrs-mrs.fr/˜pedro/CAZY/ghf_—22.html] comprises enzymes with two known activities; lysozyme type C (EC 3.2.1.17) and alpha-lactalbumins.

The domain results illustrated above also demonstrate that NOV6 contains the lysozyme C domain from the alpha lactalbumin family. Lysozyme type C and alpha-lactalbumin are similar both in terms of primary sequence and structure, and probably evolved from a common ancestral protein. Approximately 35 to 40% of the residues are conserved in both of the proteins, as well as the positions of the four disulfide bonds in each. Disulfide bonds are between Cysteine n and Cysteine n+2, e.g., the first and third cysteines. See, Prosite PDOC00119 for a diagram of the signature sequence.

Lysozyme catalyses the hydrolysis of bacterial cell wall polysaccharides; it has also been recruited for a digestive role in certain ruminants and colobine monkeys (Irwin and Wilson, J. Biol. Chem. 264:11387-11393, 1989). Another significant difference between the two enzymes is that all lactalbumins have the ability to bind calcium (Stuart et al., Nature 324:84-87, 1986), while this property is restricted to only a few lysozymes (Nitta et al., FEBS Lett., 223:405-408, 1987).

Lysozyme catalyzes the hydrolysis of certain mucopolysaccharides of bacterial cell walls. Specifically, it catalyzes the hydrolysis of the bacterial cell wall beta(1-4) glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine. It is found in spleen, lung, kidney, white blood cells, plasma, saliva, milk and tears. Fleming and Allison (Brit. J. Exp. Path.3: 252- 260, 1922) demonstrated an unusually high concentration in cartilage, indeed the highest of any tissue. Its role in cartilage is unknown. Neufeld (Personal Communication. Bethesda, Md., 1972) suggested that a genetic defect of lysozyme might underlie a skeletal dysplasia. Spitznagel et al. ((Abstract) J. Clin. Invest. 51: 93A only, 1 972) observed a patient with selective deficiency of a particular type of neutrophil granule which resulted in about 50% reduction in lysozyme levels. The patient showed increased susceptibility to infection.

Prieur et al. (Am. J. Path. 77: 283-296,1974) described inherited lysozyme deficiency in rabbits. No abnormality of cartilage or bone was noted (Greenwald et al., Biochim. Biophys. Acta 385: 435-437,1975). Older mutant rabbits showed increased susceptibility to infections, especially subcutaneous abscesses (Personal Communication. Pullman, Wash., May 13, 1975.). Camara et al. (Lab. Invest. 63: 544-550,1990) identified 2 isozymes of rabbit lysozyme and showed that their distribution was tissue specific. Leukocytic and gastrointestinal isozymes were clearly distinguished, and a possible lymphoepithelial isozyme that resembled the gastrointestinal isozyme electrophoretically and chromatographically but not kinetically was demonstrated. Mutant, lysozyme-deficient rabbits completely lacked a detectable leukocytic isozyme but had gastrointestinal and lymphoepithelial isozymes indistinguishable from those of normal rabbits. By electrophoretic methods, the mutant rabbits were shown to lack a protein band corresponding to that of the leukocytic isozyme in normal rabbits.

Yoshimura et al. (Biochem. Biophys. Res. Commun. 150:794-801,1988) isolated a cDNA encoding human lysozyme from a human placenta cDNA library. The 1.5-kb cDNA coded for a signal peptide consisting of 18 amino acids and for mature lysozyme. The amino acid sequence of the mature lysozyme, deduced from the nucleotide sequence, was identical with the published sequence. Human lysozyme has 130 amino acid residues and 4 disulfide bonds (Taniyama et al., J. Biol. Chem. 266: 6456-6461, 1991). Peters et al. ((Abstract) Cytogenet. Cell Genet. 51: 1059 only,1989) described the isolation of 2 overlapping genomic clones containing 25 kb of the human lysozyme gene region. They also isolated a full-length human lysozyme cDNA clone from a human placental cDNA library. They reported on the nucleotide sequence of the entire structural gene and the cDNA clone. Using a panel of somatic cell hybrids, Peters et al. (Biochemistry 38: 6419-6427,1989) assigned the lysozyme gene to human chromosome 12.

Canet et al. (1999) studied the unfolding and refolding properties of human lysozyme and 2 of its amyloidogenic variants, ile56 to thr and asp67 to his, by stopped-flow fluorescence and hydrogen exchange pulse labeling coupled with mass spectrometry. Their results suggested that the amyloidogenic nature of the lysozyme variants arises from a decrease in the stability of the native fold relative to partially folded intermediates. The origin of this instability was different in the 2 variants, being caused in one case primarily by a reduction in the folding rate and in the other by an increase in the unfolding rate. In both cases, this resulted in a low population of soluble partially folded species that can aggregate in a slow and controlled manner to form amyloid fibrils.

In the human, mutations in the LYZ gene in renal amyloidosis represented the first link of lysozyme to genetic disease (see OMIM 153450, 153450.0001 and 153450.0002). See generally, Prosite PDC00119, Interpro entries IPR001916, IPR000974 and IPR000545.

The disclosed NOV6 lysozyme C-1 precursor-like protein maps to chromosome Xp11.1-11.3. This information was assigned using OMIM, the electronic northern bioinformatic tool implemented by CuraGen Corporation, public ESTs, public literature references and/or genomic clone hom*ologies. This was executed to derive the chromosomal mapping of the SeqCalling assemblies, Genomic clones, literature references and/or EST sequences that were included in the invention.

The disclosed NOV6a lysozyme C-1 precursor-like protein is expressed in at least the following tissues: cartilage, testis, fetal brain, spleen, lung, kidney, white blood cells, plasma, saliva, milk, tears. This information was derived by determining the tissue sources of the sequences that were included in the invention including but not limited to SeqCalling sources, Public EST sources, Genomic Clone sources, Literature sources, and/or RACE sources.

The protein similarity information, expression pattern, and map location for the lysozyme C-1 precursor-like protein and nucleic acid disclosed herein suggest that this lysozyme C-1 precursor may have important structural and/or physiological functions characteristic of the lysozyme C-1 precursor family, and the related glycoside hydrolase family. Therefore, the novel nucleic acids and NOV6 proteins of the invention, or fragments thereof, are useful in potential diagnostic and therapeutic applications and as a research tool. These include serving as a specific or selective nucleic acid or protein diagnostic and/or prognostic marker, wherein the presence or amount of the nucleic acid or the protein are to be assessed, swell as potential therapeutic applications such as the following: (i)a protein therapeutic, (ii) a small molecule drug target, (iii) an antibody target (therapeutic, diagnostic, drug targeting/cytotoxic antibody), (iv) a nucleic acid useful in gene therapy (gene delivery/gene ablation), and (v) a composition promoting tissue regeneration in vitro and in vivo (vi) biological defense weapon.

The NOV6 nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications implicated in various diseases and disorders described below and/or other pathologies. For example, the compositions of the present invention will have efficacy for treatment of patients suffering from: susceptibility to infection, amyloidosis; blood disorders including hemophilia and hypercoagulation; salivitory disorders, digestive disorders, inflammatory processes, muscle, bone and tendon disorders; idiopathic thrombocytopenic purpura; immunodeficiencies; graft versus host; infection; systemic lupus erythematosus; autoimmune disease; asthma, emphysema; scleroderma; allergy; ARDS; diabetes; renal artery stenosis; interstitial nephritis; glomerulonephritis; polycystic kidney disease; Renal tubular acidosis; IgA nephropathy; hypercalceimia; Lesch-Nyhan syndrome; renal amyloidosis; arthritis; tendonitis; reproductive disorders, chorioathetosis with mental retardation and abnormal behavior; renal cell carcinoma, papillary, 2; renpenning syndrome-1; sarcoma, synovial; arthrogryposis, X-linked (spinal muscular atrophy, infantile, X-linked) mental retardation syndrome; X-linked, siderius type mental retardation; X-linked 14 mental retardation; X-linked nonspecific, type 50 mental retardation; X-linked, syndromic 7 mental retardation; retinitis pigmentosa-2; Von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain and other diseases, disorders and conditions of the like.

The polypeptides can be used as immunogens to produce antibodies specific for the invention, and as vaccines. They can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding the lysozyme C-like protein may be useful in gene therapy, and the Lysozyme C-like protein may be useful when administered to a subject in need thereof. These materials are further useful in the generation of antibodies that bind immuno-specifically to the novel NOV6 substances for use in therapeutic or diagnostic methods. These antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the “Anti-NOVX Antibodies” section below.

NOV6b has been analyzed for tissue expression profiles as described in Example 1 below.

NOV7

NOV7 includes a family of three similar nucleic acids and three similar proteins, designated NOV7a, NOV7b, and NOV7c, disclosed below. The disclosed nucleic acids encode proteins belonging to the immunoglobulin superfamily.

NOV7a

The disclosed nucleic acid sequence for NOV7a has 2649 of 2659 bases (99%) identical to hom*o sapiens cDNA FLJ12646 fis, clone NT2RM4001987 weakly similar to Neural cell adhesion molecule 1, large isoform precursor (GENBANK-ID:AK022708|acc:AK022708.1) Similarly, the full NOV7a amino acid sequence was found to have 556 of 572 amino acid residues (97%) identical to, and 558 of 572 amino acid residues (97%) similar to, the 571 amino acid residue to hom*o sapiens cDNA FLJ12646 FIS, Clone NT2RM4001987 weakly similar to Neural cell adhesion molecule 1, large isoform precursor (SPTREMBL-ACC:Q9H9N1). Cell adhesion molecules are a subset of the immunoglobulin superfamily of proteins.

Based on its relatedness to the neural cell adhesion molecule and the presence of immunoglobulin-like domains, the NOV7a protein is a novel cell adhesion molecule belonging to the immunoglobulin superfamily of proteins.

The NOV7a gene is expressed in adrenal gland, bone marrow, brain-amygdala, brain-cerebellum, brain-hippocampus, brain-substantia nigra, brain-thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma-Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus. Accordingly, a NOV7a nucleic acid is useful in identifying these tissue types.

NOV7b

The NOV7b gene is expressed in lymph node, ovary, fetal lung, fetal kidney and adrenal gland. Accordingly, a NOV7b nucleic acid is useful in identifying these tissue types.

In a search of sequence databases, it was found, for example, that the NOV7b polypeptide sequence has 410 of 410 amino acids (100%) identical to irregular chiasm c-roughest protein precursor from hom*o sapiens (GenBank Accession No. BAA91850).

NOV7c

The NOV7c gene is expressed in lymph node, ovary and adrenal gland. Accordingly, a NOV7c nucleic acid is useful in identifying these tissue types.

In a search of sequence databases, it was found, for example, that the NOV7c polypeptide sequence has 45 of 135 amino acids (33%) identical to F22162_—1 from hom*o sapiens (GenBank Accession No. Q9Y4A4).

Unless specifically addressed as NOV7a, NOV7b or NOV7c, any reference to NOV7 is assumed to encompass all variants. Residue differences between any NOVX variant sequences herein are written to show the residue in the “a” variant and the residue position with respect to the “a”varient. NOV7 residues in all following sequence alignments that differ between the individual NOV7 variants are highlighted with a box and marked with the (o) symbol above the variant residue in all alignments herein. For example, the protein shown in line 1 of Table 7L depicts the sequence for NOV7a, and the positions where NOV7b differs are marked with a (o) symbol and are highlighted with a box.

Based on sequence hom*ology with other immunoglobulin superfamily members, as well as domain information, the disclosed NOV7 proteins are likely to be involved in protein-protein and protein-ligand interactions.

The nucleic acids and proteins of NOV7 are useful in potential therapeutic applications implicated in various pathological disorders, described further below. For example, a cDNA encoding the immunoglobulin superfamily-like protein may be useful in gene therapy, and the immunoglobulin superfamily-like protein may be useful when administered to a subject in need thereof.

The nucleic acids and proteins of the invention have applications in the diagnosis and/or treatment of various diseases and disorders. For example, the compositions of the present invention will have efficacy for the treatment of patients suffering from, CNS diseases such as Parkinson's disease and Alzheimer's disease, corpus callosum agenesis, retardation, adducted thumbs, spastic paraparesis, hydrocephalus, agenesis or hypoplasia of corpus callosum, primitive neuroectodermal tumors, human neuroteratocarcinoma and other cancers, human type 2 lissencephaly, recurrent seizures and hippocampal sclerosis as well as other diseases, disorders and conditions.

The polypeptides can be used as immunogens to produce antibodies specific for the invention, and as vaccines. They can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding the immunoglobulin superfamily-protein may be useful in gene therapy, and the receptor-like protein may be useful when administered to a subject in need thereof. The novel nucleic acid encoding immunoglobulin superfamily-like proteins, and the immunoglobulin superfamily-like protein of the invention, or fragments thereof, may further be useful in diagnostic applications, wherein the presence or amount of the nucleic acid or the protein are to be assessed. These materials are further useful in the generation of antibodies that bind immunospecifically to the novel substances of the invention for use in therapeutic or diagnostic methods. These antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the “Anti-NOVX Antibodies” section below. For example the disclosed NOV7 protein has multiple hydrophilic regions, each of which can be used as an immunogen. This novel protein also has value in development of powerful assay system for functional analysis of various human disorders, which will help in understanding of pathology of the disease and development of new drug targets for various disorders.

TaqMan data are presented in Example 1.

The quantitative expression of various clones was assessed using microtiter plates containing RNA samples from a variety of normal and pathology-derived cells, cell lines and tissues using real time quantitative PCR (RTQ PCR; TAQMAN®). RTQ PCR was performed on a Perkin-Elmer Biosystems ABI PRISM® 7700 Sequence Detection System. Various collections of samples are assembled on the plates, and referred to as Panel 1 (containing cells and cell lines from normal and cancer sources), Panel 2 (containing samples derived from tissues, in particular from surgical samples, from normal and cancer sources), Panel 3 (containing samples derived from a wide variety of cancer sources) and Panel 4 (containing cells and cell lines from normal cells and cells related to inflammatory conditions).

First, the RNA samples were normalized to constitutively expressed genes such as β-actin and GAPDH. RNA (˜50 ng total or ˜1 ng polyA+) was converted to cDNA using the TAQMAN® Reverse Transcription Reagents Kit (PE Biosystems, Foster City, Calif.; Catalog No. N808-0234) and random hexamers according to the manufacturer's protocol. Reactions were performed in 20 ul and incubated for 30 min. at 48° C. cDNA (5 ul) was then transferred to a separate plate for the TAQMAN® reaction using β-actin and GAPDH TAQMAN® Assay Reagents (PE Biosystems; Catalog Nos. 4310881E and 4310884E, respectively) and TAQMAN® universal PCR Master Mix (PE Biosystems; Catalog No. 4304447) according to the manufacturer's protocol. Reactions were performed in 25 ul using the following parameters: 2 min. at 50° C.; 10 min. at 95° C.; 15 sec. at 95° C./1 min. at 60° C. (40 cycles). Results were recorded as CT values (cycle at which a given sample crosses a threshold level of fluorescence) using a log scale, with the difference in RNA concentration between a given sample and the sample with the lowest CT value being represented as 2 to the power of delta CT. The percent relative expression is then obtained by taking the reciprocal of this RNA difference and multiplying by 100. The average CT values obtained for β-actin and GAPDH were used to normalize RNA samples. The RNA sample generating the highest CT value required no further diluting, while all other samples were diluted relative to this sample according to their β-actin /GAPDH average CT values.

Normalized RNA (5 ul) was converted to cDNA and analyzed via TAQMAN® using One Step RT-PCR Master Mix Reagents (PE Biosystems; Catalog No. 4309169) and gene-specific primers according to the manufacturer's instructions. Probes and primers were designed for each assay according to Perkin Elmer Biosystem's Primer Express Software package (version I for Apple Computer's Macintosh Power PC) or a similar algorithm using the target sequence as input. Default settings were used for reaction conditions and the following parameters were set before selecting primers: primer concentration =250 nM, primer melting temperature (T_m) range=58°-60° C., primer optimal Tm=59° C., maximum primer difference=2° C., probe does not have 5′ G, probe T_m must be 10° C. greater than primer T_m, amplicon size 75 bp to 100 bp. The probes and primers selected (see below) were synthesized by Synthegen (Houston, Tex., USA). Probes were double purified by HPLC to remove uncoupled dye and evaluated by mass spectroscopy to verify coupling of reporter and quencher dyes to the 5′ and 3′ ends of the probe, respectively. Their final concentrations were: forward and reverse primers, 900 nM each, and probe, 200nM.

PCR conditions: Normalized RNA from each tissue and each cell line was spotted in each well of a 96 well PCR plate (Perkin Elmer Biosystems). PCR co*cktails including two probes (a probe specific for the target clone and another gene-specific probe multiplexed with the target probe) were set up using 1X TaqMan™ PCR Master Mix for the PE Biosystems 7700, with 5 mM MgCl2, dNTPs (dA, G, C, U at 1:1:1:2 ratios), 0.25 U/ml AmpliTaq Gold™ (PE Biosystems), and 0.4 U/μl RNase inhibitor, and 0.25 U/μl reverse transcriptase. Reverse transcription was performed at 48° C. for 30 minutes followed by amplification/PCR cycles as follows: 95° C. 10 min, then 40 cycles of 95° C. for 15 seconds, 60° C. for 1 minute.

In the results for Panel 1, the following abbreviations are used:

ca.=carcinoma,

*=established from metastasis,

met=metastasis,

s cell var=small cell variant,

non-s=non-sm=non-small,

squam=squamous,

pl. eff=pl effusion=pleural effusion,

glio=glioma,

astro=astrocytoma, and

neuro=neuroblastoma.

Panel 2

The plates for Panel 2 generally include 2 control wells and 94 test samples composed of RNA or cDNA isolated from human tissue procured by surgeons working in close cooperation with the National Cancer Institute's Cooperative Human Tissue Network (CHTN) or the National Disease Research Initiative (NDRI). The tissues are derived from human malignancies and in cases where indicated many malignant tissues have “matched margins” obtained from noncancerous tissue just adjacent to the tumor. These are termed normal adjacent tissues and are denoted “NAT” in the results below. The tumor tissue and the “matched margins” are evaluated by two independent pathologists (the surgical pathologists and again by a pathologists at NDRI or CHTN). This analysis provides a gross histopathological assessment of tumor differentiation grade. Moreover, most samples include the original surgical pathology report that provides information regarding the clinical stage of the patient. These matched margins are taken from the tissue surrounding (i.e. immediately proximal) to the zone of surgery (designated “NAT”, for normal adjacent tissue). In addition, RNA and cDNA samples were obtained from various human tissues derived from autopsies performed on elderly people or sudden death victims (accidents, etc.). These tissue were ascertained to be free of disease and were purchased from various commercial sources such as Clontech (Palo Alto, Calif.), Research Genetics, and Invitrogen.

RNA integrity from all samples is controlled for quality by visual assessment of agarose gel electropherograms using 28S and 18S ribosomal RNA staining intensity ratio as a guide (2:1 to 2.5:1 28s: 1 8s) and the absence of low molecular weight RNAs that would be indicative of degradation products. Samples are controlled against genomic DNA contamination by RTQ PCR reactions run in the absence of reverse transcriptase using probe and primer sets designed to amplify across the span of a single exon.

Panel 3D

The plates of Panel 3D are comprised of 94 cDNA samples and two control samples. Specifically, 92 of these samples are derived from cultured human cancer cell lines, 2 samples of human primary cerebellar tissue and 2 controls. The human cell lines are generally obtained from ATCC (American Type Culture Collection), NCI or the German tumor cell bank and fall into the following tissue groups: Squamous cell carcinoma of the tongue, breast cancer, prostate cancer, melanoma, epidermoid carcinoma, sarcomas, bladder carcinomas, pancreatic cancers, kidney cancers, leukemias/lymphomas, ovarian/uterine/cervical, gastric, colon, lung and CNS cancer cell lines. In addition, there are two independent samples of cerebellum. These cells are all cultured under standard recommended conditions and RNA extracted using the standard procedures. The cell lines in panel 3D and 1.3D are of the most common cell lines used in the scientific literature.

RNA integrity from all samples is controlled for quality by visual assessment of agarose gel electropherograms using 28S and 18S ribosomal RNA staining intensity ratio as a guide (2:1 to 2.5:1 28s:18s) and the absence of low molecular weight RNAs that would be indicative of degradation products. Samples are controlled against genomic DNA contamination by RTQ PCR reactions run in the absence of reverse transcriptase using probe and primer sets designed to amplify across the span of a single exon.

Panel 4

Panel 4 includes samples on a 96 well plate (2 control wells, 94 test samples) composed of RNA (Panel 4r) or cDNA (Panel 4d) isolated from various human cell lines or tissues related to inflammatory conditions. Total RNA from control normal tissues such as colon and lung (Stratagene, La Jolla, Calif.) and thymus and kidney (Clontech) were employed. Total RNA from liver tissue from cirrhosis patients and kidney from lupus patients was obtained from BioChain (Biochain Institute, Inc., Hayward, Calif.). Intestinal tissue for RNA preparation from patients diagnosed as having Crohn's disease and ulcerative colitis was obtained from the National Disease Research Interchange (NDRI) (Philadelphia, Pa.).

Astrocytes, lung fibroblasts, dermal fibroblasts, coronary artery smooth muscle cells, small airway epithelium, bronchial epithelium, microvascular dermal endothelial cells, microvascular lung endothelial cells, human pulmonary aortic endothelial cells, human umbilical vein endothelial cells were all purchased from Clonetics (Walkersville, Md.) and grown in the media supplied for these cell types by Clonetics. These primary cell types were activated with various cytokines or combinations of cytokines for 6 and/or 12-14 hours, as indicated. The following cytokines were used; IL-1 beta at approximately 1-5 ng/ml, TNF alpha at approximately 5-10 ng/ml, IFN gamma at approximately 20-50 ng/ml, IL-4 at approximately 5-10 ng/ml, IL-9 at approximately 5-10 ng/ml, IL-13 at approximately 5-10 ng/ml. Endothelial cells were sometimes starved for various times by culture in the basal media from Clonetics with 0.1% serum.

Mononuclear cells were prepared from blood of employees at CuraGen Corporation, using Ficoll. LAK cells were prepared from these cells by culture in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco/Life Technologies, Rockville, Md.), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), and 10 mM Hepes (Gibco) and Interleukin 2 for 4-6 days. Cells were then either activated with 10-20 ng/ml PMA and 1-2 μg/ml ionomycin, IL-12 at 5-10 ng/ml, IFN gamma at 20-50 ng/ml and IL-I 8 at 5-10 ng/ml for 6 hours. In some cases, mononuclear cells were cultured for 4-5 days in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), and 10 mM Hepes (Gibco) with PHA (phytohemagglutinin) or PWM (pokeweed mitogen) at approximately 5 μg/ml. Samples were taken at 24, 48 and 72 hours for RNA preparation. MLR (mixed lymphocyte reaction) samples were obtained by taking blood from two donors, isolating the mononuclear cells using Ficoll and mixing the isolated mononuclear cells 1:1 at a final concentration of approximately 2×10⁶ cells/ml in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol (5.5×10⁻⁵ M) (Gibco), and 10 mM Hepes (Gibco). The MLR was cultured and samples taken at various time points ranging from 1-7 days for RNA preparation.

Monocytes were isolated from mononuclear cells using CD14 Miltenyi Beads, +ve VS selection columns and a Vario Magnet according to the manufacturer's instructions. Monocytes were differentiated into dendritic cells by culture in DMEM 5% fetal calf serum (FCS) (Hyclone, Logan, Utah), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), and 10 mM Hepes (Gibco), 50 ng/ml GMCSF and 5 ng/ml IL-4 for 5-7 days. Macrophages were prepared by culture of monocytes for 5-7 days in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10-5 M (Gibco), 10 mM Hepes (Gibco) and 10% AB Human Serum or MCSF at approximately 50 ng/ml. Monocytes, macrophages and dendritic cells were stimulated for 6 and 12-14 hours with lipopolysaccharide (LPS) at 100 ng/ml. Dendritic cells were also stimulated with anti-CD40 monoclonal antibody (Pharmingen) at 10 μg/ml for 6 and 12-14 hours.

CD4 lymphocytes, CD8 lymphocytes and NK cells were also isolated from mononuclear cells using CD4, CD8 and CD56 Miltenyi beads, positive VS selection columns and a Vario Magnet according to the manufacturer's instructions. CD45RA and CD45RO CD4 lymphocytes were isolated by depleting mononuclear cells of CD8, CD56, CD14 and CD19 cells using CD8, CD56, CD14 and CD19 Miltenyi beads and positive selection. Then CD45RO beads were used to isolate the CD45RO CD4 lymphocytes with the remaining cells being CD45RA CD4 lymphocytes. CD45RA CD4, CD45RO CD4 and CD8 lymphocytes were placed in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), and 10 mM Hepes (Gibco) and plated at 10⁶ cells/ml onto Falcon 6 well tissue culture plates that had been coated overnight with 0.5 μg/ml anti-CD28 (Pharmingen) and 3 ug/ml anti-CD3 (OKT3, ATCC) in PBS. After 6 and 24 hours, the cells were harvested for RNA preparation. To prepare chronically activated CD8 lymphocytes, we activated the isolated CD8 lymphocytes for 4 days on anti-CD28 and anti-CD3 coated plates and then harvested the cells and expanded them in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), and 10 mM Hepes (Gibco) and IL-2. The expanded CD8 cells were then activated again with plate bound anti-CD3 and anti-CD28 for 4 days and expanded as before. RNA was isolated 6 and 24 hours after the second activation and after 4 days of the second expansion culture. The isolated NK cells were cultured in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), and 10 mM Hepes (Gibco) and IL-2 for 4-6 days before RNA was prepared.

To obtain B cells, tonsils were procured from NDRI. The tonsil was cut up with sterile dissecting scissors and then passed through a sieve. Tonsil cells were then spun down and resupended at 10⁶ cells/ml in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), and 10 mM Hepes (Gibco). To activate the cells, we used PWM at 5 μg/ml or anti-CD40 (Pharmingen) at approximately 10 μg/ml and IL-4 at 5-10 ng/ml. Cells were harvested for RNA preparation at 24,48 and 72 hours.

To prepare the primary and secondary Th1/Th2 and Tr1 cells, six-well Falcon plates were coated overnight with 10 μg/ml anti-CD28 (Pharmingen) and 2 μg/ml OKT3 (ATCC), and then washed twice with PBS. Umbilical cord blood CD4 lymphocytes (Poietic Systems, German Town, Md.) were cultured at 10⁵-10⁶ cells/ml in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵M (Gibco), 10 mM Hepes (Gibco) and IL-2 (4 ng/ml). IL-12 (5 ng/ml) and anti-IL4 (1 μg/ml) were used to direct to Th1, while IL-4 (5 ng/ml) and anti-IFN gamma (1 μg/ml) were used to direct to Th2 and IL-10 at 5 ng/ml was used to direct to Tr1. After 4-5 days, the activated Th1, Th2 and Tr1 lymphocytes were washed once in DMEM and expanded for 4-7 days in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), 10 mM Hepes (Gibco) and IL-2 (1 ng/ml). Following this, the activated Th1, Th2 and Tr1 lymphocytes were re-stimulated for 5 days with anti-CD28/OKT3 and cytokines as described above, but with the addition of anti-CD95L (1 μg/ml) to prevent apoptosis. After 4-5 days, the Th1, Th2 and Tr1 lymphocytes were washed and then expanded again with IL-2 for 4-7 days. Activated Th1 and Th2 lymphocytes were maintained in this way for a maximum of three cycles. RNA was prepared from primary and secondary Th1, Th2 and Tr1 after 6 and 24 hours following the second and third activations with plate bound anti-CD3 and anti-CD28 mAbs and 4 days into the second and third expansion cultures in Interleukin 2.

The following leukocyte cells lines were obtained from the ATCC: Ramos, EOL-1, KU-812. EOL cells were further differentiated by culture in 0.1 mM dbcAMP at 5×10⁵ cells/ml for 8 days, changing the media every 3 days and adjusting the cell concentration to 5×10⁵ cells/ml. For the culture of these cells, we used DMEM or RPMI (as recommended by the ATCC), with the addition of 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10-5 M (Gibco), 10 mM Hepes (Gibco). RNA was either prepared from resting cells or cells activated with PMA at 10 ng/ml and ionomycin at 1 μg/ml for 6 and 14 hours. Keratinocyte line CCD1106 and an airway epithelial tumor line NCI-H292 were also obtained from the ATCC. Both were cultured in DMEM 5% FCS (Hyclone), 100 μM non essential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), mercaptoethanol 5.5×10⁻⁵ M (Gibco), and 10 mM Hepes (Gibco). CCD1106 cells were activated for 6 and 14 hours with approximately 5 ng/ml TNF alpha and 1 ng/ml IL-1 beta, while NCI-H292 cells were activated for 6 and 14 hours with the following cytokines: 5 ng/ml IL-4, 5 ng/ml IL-9, 5 ng/ml IL-13 and 25 ng/ml IFN gamma.

For these cell lines and blood cells, RNA was prepared by lysing approximately 10⁷ cells/ml using Trizol (Gibco BRL). Briefly, 1/10 volume of bromochloropropane (Molecular Research Corporation) was added to the RNA sample, vortexed and after 10 minutes at room temperature, the tubes were spun at 14,000 rpm in a Sorvall SS34 rotor. The aqueous phase was removed and placed in a 15 ml Falcon Tube. An equal volume of isopropanol was added and left at −20 degrees C overnight. The precipitated RNA was spun down at 9,000 rpm for 15 min in a Sorvall SS34 rotor and washed in 70% ethanol. The pellet was redissolved in 300 pl of RNAse-free water and 35 μl buffer (Promega) 5 μl DTT, 7 μl RNAsin and 8 VlI DNAse were added. The tube was incubated at 37 degrees C for 30 minutes to remove contaminating genomic DNA, extracted once with phenol chloroform and re-precipitated with {fraction (1/10)} volume of 3 M sodium acetate and 2 volumes of 100% ethanol. The RNA was spun down and placed in RNAse free water. RNA was stored at −80 degrees C.

NOV1a